Effect of Hydrogen Peroxide on Cyclic Fatigue Resistance of NiTi Endodontic Files

Huma Sarwar                               BDS, MDS

Meshal M Naeem                         BDS

Sumaiya Shabbir                         BDS, MSc

Sania Riaz                                      BDS, MSc

Hasan Afaq                                   BDS, MDS

Juzer Shabbir                              BDS, MDS

OBJECTIVE: To investigate the effect of nickel titanium rotary endodontic file immersion in hydrogen peroxide on cyclic fatigue resistance.
METHODOLOGY:
Twenty Six Protaper Universal (Dentsply Maillerfier) F1 files were randomly divided into two experimental groups. In Group I, Protaper universal variable taper F1 files were immersed in normal saline where as in Group II, the files were soaked in hydrogen peroxide (6% w/v) for 2 hours at 37°C. Cyclic fatigue of each file was checked by recording the number of rotations required to break a file in a 90°curve with a 5 mm radius. For statistical analysis of data, Two-way ANOVA was applied. A p value of <0.05 was considered significant.
RESULT:
Out of Twenty Six, Six files fractured spontaneously after immersion in hydrogen peroxide. Twenty files were subjected to fracture resistance testing. Statistically significant difference in cyclic fatigue resistace between the two groups was found (p=0.002). The files soaked in Group II required less revolutions to fracture than the ones immersed Group I.
CONCLUSION: T
he immersion of NiTi endodontic files in hydrogen peroxide significantly reduces cyclic fatigue resistance. Therefore, immersion of the NiTi endodontic files in hydrogen peroxide solution for removal of clogged debris should be discouraged.
KEYWORDS:
Cyclic fatigue, Endodontic instruments, Hydrogen peroxide, NiTi
HOW TO CITE:
Sarwar H, Naeem MM, Shabbir S, Riaz S, Afaq H, Shabbir J. Effect of hydrogenperoxide on cyclic fatigue resistance of NiTi endodontic files. J Pak Dent Assoc 2020;29(4):246-248.
DOI:
https://doi.org/10.25301/JPDA.294.246
Received:
10 March 2020, Accepted: 15 August 2020

INTRODUCTION

Endodontic therapy is aimed to shape and clean roots canals to an adequate geometry. The main objective of the mechanical preparation is to optimize the disinfection and subsequent obturation of the whole root canal system.1 Endodontic files are used to shape root canal mechanically. Hydrogen peroxide has been used as an endodontic irrigant in varying concentrations. Although the current evidence does not support the use of hydrogen peroxide over other contemporary irrigants, it is still used by dental practitioners to remove dentine debris from endodontic files. According to the Archimedes screw effect, the flutes of the files tend to transport clogged dentinal debris coronally during endodontic preparation.2 The clogged debris compromises the cleaning efficiency of the endodontic instrument. Hence, the cleaning of the endodontic instrument is mandatory before it can be used again. To date, there is no standardized method for cleaning endodontic files after usage. The files can either be cleaned by wiping with gauze or sponge soaked with alcohol or by using an ultrasonic bath.3 In our part of the world, most of the dental practitioners prefer to soak freshly used endodontic files in agents such as sodium hypochlorite or hydrogen peroxide for this purpose.4 There is a high risk of endodontic NiTi rotary instruments fracture because of torsional shear stresses and cyclic fatigue.5 The mechanical properties of rotary instruments are also compromised by when the files remain in contact with chemicals for the longer time duration. Sodium hypochlorite has proven to decrease the cyclic fatigue resistance of rotary files.6 Rotations around a curve causing repeated compression and extension of a metal results in work hardening and eventually separation of the instrument. This phenomenon is known as cyclic fatigue of an instrument. Now days efforts are being made to identify the factors and that effect the cyclic fatigue of the endodontic instruments. Nickel Titanium (NiTi) surfaces are being modified by electro-polishing and ion deposition to enhance mechanical properties.7 Corrosion in the presence of solution used during root canal treatment is another important factor affecting the mechanical strength of NiTi files.8 Because of its tissue dissolving and hemostatic properties, hydrogen peroxide was used as an intracanal irrigant. Sodium hypochlorite is gold standard endodontic irrigant known for its tissue dissolving properties. According to the literature, sodium
hypochlorite tends to corrode NiTi and stainless steel files structure.9 But the effect of hydrogen peroxide on mechanical properties of Niti endodontic files is not known. Therefore,
the objective of the present study was to evaluate the effect of hydrogen peroxide on the cyclic fatigue resistance of NiTi endodontic files.

METHODOLGY

Twenty-six Protaper universal (Dentsply Maillerfier) F1 variable taper files were used in this study. Files were divided randomly int two groups. In Group I (Control group), the files were soaked in normal saline. In Group II (experimental Group), the files were soaked in hydrogen peroxide. The files were stored at room temperature for 2 hours in glass vials according to the assigned group and after removal were wiped with gauze. Files were then tested for cyclic fatigue after air drying by using universal testing machine. A tempered
steel rod and a block assembled with a 5mm radius and 90° angle were used to evaluate fracture resistance by measuring the number of rotations to fracture. Files were immersed in
neighbourhoods in a way that their tips were extending out of the rod. 240 rpm rotational speed was set. The number of rotations required to fracture the files was calculated. The lubricant was used to reduce heat generation. Scheffe post hoc test and Two-way analysis were used at =0.05 for the evaluation of the data. The number of rotations, angle and torque were dependent variables.

RESULTS

Three files from both groups i.e six out of twenty six endodontic files showed obvious signs of corrosion and resulted in breakage. Twenty files were subjected to evaluation of fatigue resistance testing. According to the results, the maximum and minimum number of rotations required to

Table 1: Comparison of mean revolutions to facture for hydrogen peroxide and normal saline groups

90° curve; 5mm radius of curvature* p-values < 0.05 considered as significant (ANOVA)

fracture the files was 80 and 229. Statistically significant difference in number of revolutions required to fracture the files was found between Group I and Group II (p<0.05).The
files in Group I showed significantly higher resistance to cyclic fracture as compared to Group II (Table 1).

DISCUSSION

Hydrogen peroxide has been used as an intracanal irrigant for many years. Its use as an intracanal irrigation solution is no more recommended. Still, many general dental practitioners use hydrogen peroxide as an irrigant and also the removal of clogged debris removal from endodontic files after use. The present study evaluated the effect of immersion of rotary Protaper F1 file in hydrogen peroxide solution (6% w/v) marked reduction in fatigue resistance was noted. The tested platform used in this study has been extensively used in the past for evaluation of fatigue resistance. It is worth noting that before immersion of files in hydrogen peroxide, Protaper Universal F1 files were more resistant to fatigue. For the testing of fatigue resistance, the design described in another study10 was used. As the heat negatively affects the fatigue resistance, measures were taken to avoid overheating of the rod and block assembly.11 Conditions tested were similar in other studies12,13 in comparison to present experiment. It has been suggested that more rapid and frequent corrosion occurs when the working part and the shank of the instrument is immersed into the solution which enables galvanic corrosion.12,13 Many studies reported the effect of sodium hypochlorite solution on the physical properties of endodontic files. The results showed significant reduction in torsional and fatigue resistance when files were soaked in sodium hypochlorite resulting in corrosion.6,9
There is no consensus yet if corrosion presents a clinical problem. Though it may be challenging to remove adhering material from the used endodontic file without its complete immersion in solution, it is still not known if the cleaning protocol of the endodontic rotary files is capable of eliminating the adhere dentinal debris completely.14,15
Gross signs of corrosion were present in 6 of 25 NiTi endodontic files placed in hydrogen peroxide solution. This observation is most likely because of the galvanic corrosion. In a few files, galvanic corrosion leads to swift total destruction and only mild pitting and surface changes in other endodontic files. Potential mechanism of galvanic cell development is a breach of nickel or gold plating in the handle part. Galvanic corrosion results in nobular areas that give an image of sponge-like structure.16 Manufacturing marks are the minor defects that may initiate subsequent file separation. It can be postulated from this study that localized and small areas of pitting corrosion reduces the cyclic fatigue of NiTi endodontic instruments.

CONCLUSION

This is apparent from this study that a high risk of corrosion is associated with soaking endodontic files in hydrogen peroxide solution. Therefore, immersion of files in hydrogen peroxide for removal of attached debris is not recommended.

CONFLICT OF INTEREST

None

FINANCIAL DISCLOSURE

None

REFERENCES

  1. Tziafas D, Alraeesi D, Al Hormoodi R, Ataya M, Fezai H, Aga N. Preparation prerequisites for effective irrigation of apical root canal: a critical review. J Clin Exp Dent . 2017;9(10):e1256. https://doi.org/10.4317/jced.54117
  2. Carrotte PV. Current practice in endodontics: 4. A review of techniques for canal preparation. Dent Update. 2000;27:488-93. https://doi.org/10.12968/denu.2000.27.10.488
  3. Murgel CAF, Walton RE, Rittman B, Pécora JD. A comparison of techniques for cleaning endodontic files after usage: a quantitative scanning electron microscopic study.J Endod 1990;16:214-7. https://doi.org/10.1016/S0099-2399(06)81672-9
  4. Sarwar, Huma et al. “Knowledge and Attitute of Dental Practitioners of Karachi towards Usage of Endodontic Files: A Cross Sectional Study.Saudi J Oral Dent Res 2019;4:747-50 https://doi.org/10.36348/SJODR.2019.v04i10.010
  5. Yao JH, Schwartz SA, Beeson TJ. Cyclic fatigue of three types of rotary nickel-titanium files in a dynamic model. J Endod 2006;32:55-7. https://doi.org/10.1016/j.joen.2005.10.013
  6. Elnaghy A, Elsaka S. Effect of sodium hypochlorite and saline on cyclic fatigue resistance of WaveOne Gold and Reciproc reciprocating instruments. Int Endod J 2017;50:991-98. https://doi.org/10.1111/iej.12712
  7. Anderson ME, Price JW, Parashos P. Fracture resistance of electropolished rotary nickel-titanium endodontic instruments. J Endod 2007;33:1212-16. https://doi.org/10.1016/j.joen.2007.07.007
  8. O’hoy P, Messer H, Palamara J. The effect of cleaning procedures on fracture properties and corrosion of NiTi files. Int Endod J 2003;36:724-32. https://doi.org/10.1046/j.1365-2591.2003.00709.x
  9. Peters OA, Roehlike JO, Baumann MA. Effect of immersion in sodium hypochlorite on torque and fatigue resistance of nickel-titanium instruments. J Endod 2007;33:589-93.
    https://doi.org/10.1016/j.joen.2007.01.007
  10. Haikel Y, Serfaty R, Bateman G, et al. Dynamic and cyclic fatigue of engine-driven rotary nickel-titanium endodontic instruments. J Endod 1999;25:434-40 https://doi.org/10.1016/S0099-2399(99)80274-X
  11. Kuhn G, Jordan L. Fatigue and mechanical properties of nickeltitanium endodontic instruments. J Endod 2002;28:716-20 https://doi.org/10.1097/00004770-200210000-00009
  12. Berutti E, Angelini E, Rigolone M, et al. Influence of sodium hypochlorite on fracture properties and corrosion of ProTaper rotary instruments. Int Endod J 2006;39:693-9. https://doi.org/10.1111/j.1365-2591.2006.01134.x
  13. Castro Martins R, Bahia MGA, Buono VTL. The effect of sodium hypochlorite on the surface characteristics and fatigue resistance of ProFile nickel-titanium instruments. Oral Surg Oral Med Oral Path Oral Radiol Endod 2006;102:99-105. https://doi.org/10.1016/j.tripleo.2006.02.018
  14. Sonntag D, Peters OA. Effect of prion decontamination protocols on Nickel-Titanium rotary surfaces. J Endod 2007; https://doi.org/10.1016/j.joen.2006.12.012
  15. Linsuwanont P, Parashos P, Messer HH. Cleaning of rotary nickeltitanium endodontic instruments. Int Endod J 2004;37:19-28 https://doi.org/10.1111/j.1365-2591.2004.00747.x
  16.  Sonntag D, Heithecker K. Korrosion von Nickel-Titan-Instrumenten. Endodontie 2006;15:23-30.

  1. Lecturer, Department of Operative Dentistry, Dow University of Health Sciences
  2. Lecturer, Department of Periodontology, Dow University of Health Sciences, Karachi
  3. Lecturer, Department of Periodontology , Dow University of Health Sciences, Karachi
  4. Lecturer, Department of Periodontology, Dow University of Health Sciences, Karachi
  5. Senior Lecturer, Department of Operative Dentistry, Baqai Dental College, Baqai Medical University.
  6. Senior Lecturer, Department of Operative Dentistry, Liaquat College of Medicine and Dentistry, Karachi.
    Corresponding author: “Dr. Huma Sarwar” < humashal@hotmail.com >

Effect of Hydrogen Peroxide on Cyclic Fatigue Resistance of NiTi Endodontic Files

Huma Sarwar                               BDS, MDS

Meshal M Naeem                         BDS

Sumaiya Shabbir                         BDS, MSc

Sania Riaz                                      BDS, MSc

Hasan Afaq                                   BDS, MDS

Juzer Shabbir                              BDS, MDS

OBJECTIVE: To investigate the effect of nickel titanium rotary endodontic file immersion in hydrogen peroxide on cyclic fatigue resistance.
METHODOLOGY:
Twenty Six Protaper Universal (Dentsply Maillerfier) F1 files were randomly divided into two experimental groups. In Group I, Protaper universal variable taper F1 files were immersed in normal saline where as in Group II, the files were soaked in hydrogen peroxide (6% w/v) for 2 hours at 37°C. Cyclic fatigue of each file was checked by recording the number of rotations required to break a file in a 90°curve with a 5 mm radius. For statistical analysis of data, Two-way ANOVA was applied. A p value of <0.05 was considered significant.
RESULT:
Out of Twenty Six, Six files fractured spontaneously after immersion in hydrogen peroxide. Twenty files were subjected to fracture resistance testing. Statistically significant difference in cyclic fatigue resistace between the two groups was found (p=0.002). The files soaked in Group II required less revolutions to fracture than the ones immersed Group I.
CONCLUSION: T
he immersion of NiTi endodontic files in hydrogen peroxide significantly reduces cyclic fatigue resistance. Therefore, immersion of the NiTi endodontic files in hydrogen peroxide solution for removal of clogged debris should be discouraged.
KEYWORDS:
Cyclic fatigue, Endodontic instruments, Hydrogen peroxide, NiTi
HOW TO CITE:
Sarwar H, Naeem MM, Shabbir S, Riaz S, Afaq H, Shabbir J. Effect of hydrogenperoxide on cyclic fatigue resistance of NiTi endodontic files. J Pak Dent Assoc 2020;29(4):246-248.
DOI:
https://doi.org/10.25301/JPDA.294.246
Received:
10 March 2020, Accepted: 15 August 2020
Download PDF

Trends in Endodontic Protocols Amongst Dentists in Lahore

Saood Khan Lodhi                                BDS

Saroosh Ehsan                                       BDS, FCPS

Adeela Rafique                                      BDS, MSc

Muhammad Nasir Saleem                BDS, FCPS, MSc

OBJECTIVES: To determine the trends in endodontic protocols amongst practicing dentists in teaching institutions and private clinics in Lahore.
METHODOLOGY:
A cross sectional survey was conducted amongst dentists working in the teaching institutions and in the private clinics of Lahore. A pre-piloted questionnaire survey adopted from Kohli et al with slight modifications was used. In this descriptive study 270 practicing dentists were selected using consecutive sampling with a 5% level of significance and margin of error.
RESULTS:
The 270 respondents had a mean age of 28.16 ± 6.18 participated in this study among which 111 (41.1%) were males and 159(58.9%) were females with the mean age of 30.28 ± 7.416 and 26.68 ± 4.62 respectively (12.2%) were consultants, 175(64.8%) were general dentists whereas 62(23%) were postgraduate residents. In our study population, 76(28.1%) dentists were using magnification among which 67(88.2%) were using loupes and 9(11.8%) were using microscope. The prevalence of the rubber dam usage for isolation among our respondents was 110(40.7%) only, 201(74.4%) dentists reported for routine removal of smear layer. Manual canal preparation technique was the most commonly used method practiced by 149(55.2%) dentists. 136(50.4%) dentists were using beveled needles for irrigation, whereas only 71(26.3%) were using side venting irrigation needles. Majority of the dentists (45.2%) were not using any method to increase the efficacy of the irrigants.
CONCLUSION:
There are deficiencies in the endodontic protocols followed by majority of the dentists in Lahore and these short comings should be addressed by governing bodies.
KEYWORDS:
Root canal therapy, Endodontic, Practice Patterns, Dentists
HOW TO CITE:
Lodhi Sk, Ehsan S, Rafique A, Saleem MN. Trends in endodontic protocols amongst dentists in Lahore. J Pak Dent Assoc 2020;29(4):239-245.
DOI:
https://doi.org/10.25301/JPDA.294.239
Received:
30 July 2020, Accepted: 08 September 2020

INTRODUCTION

Endodontics has evolved at a very fast pace in the last two decades with the help of both technology and a much-improved understanding of scientific concepts. Under the umbrella of evidence-based practices,
endodontics has propelled from blind preparation of canals to endodontics under the microscope with effective irrigation and disinfection procedures. The dental professionals are now faced with a plethora of choices in terms of equipment selection, material selection and applied technology.1 The outcome of root canal treatment is greatly reliant on maintenance of treatment standards.2 However, several studies in different parts of the world, have reported the majority of dentists not fulfilling the standard guidelines.3-7 It is therefore important to carry out a survey among dentists of a given region to see their implementation of evidence based practice in their endodontic practices.1
Studies conducted from university clinics and specialists have reported high success rate of endodontic treatment of more than 90%, However, these statistics do not define the exact success rate of endodontic treatment in general dental practice. The success rate of endodontic treatment in general dental practice estimates to 65-75% only.9 The inconsistency in success rate noted may indicate a difference in the technical quality of endodontic treatment being performed by dentists with different experience. Considering our patients’ health, it would be of utmost importance to ascertain the practices adopted by dental practitioners of a given region. Various studies conducted in different parts of the world have shown that despite the number of new innovations in dentistry, deficiencies are seen in endodontic treatment provided by practicing dentists. A national survey on trends in contemporary Endodontic practice in Pakistan done by Bhatti et al showed deficiencies among dental practitioners providing endodontic treatment.1
The rationale of this study was to collect data regarding knowledge, materials, methods, and attitudes exercised during endodontic treatment by dentists in Lahore to assess their practices and to help in enhancing the quality of endodontic treatment. No such study has been conducted at a regional level in Lahore.

METHODOLOGY

A cross sectional survey was conducted amongst dentists working in teaching institutions and in private clinics of Lahore. After approval from the Institutional Review Board (IRB) of Fatima Memorial Hospital (FMH-03-2019-IRB586-M), the study was initiated and data collection was completed in 3 months. A sample size of 278 dentists was selected using 5% level of significance, 95% confidence interval and 5% margin of error. Dentists practicing in private practices as well as in teaching institutes of Lahore were included in the inclusion criteria whereas undergraduate dental students and dental hygienists were excluded from the study. A pre piloted questionnaire survey adopted from Kohli et al with slight modifications was used. 10
The selfadministered questionnaire comprising of 26 questions covered various aspects of endodontic treatment including personal and demographic detail. The questionnaire was filled by general dentists, post-graduate residents and consultants. The anonymity of the respondents was maintained. The survey included questions concerning various aspects of endodontic treatment protocol including use of rubber dam, techniques for working length determination, use of magnification, technique for root canal instrumentation, choice of irrigants with adjuncts and needle choice, choice of intracanal medicaments, obturation techniques and choice of material for sealer. The responses were analyzed in SPSS VERSION 21 to calculate frequencies and percentages.

RESULTS

A total of 270 respondents with mean age of 28.16 ± 6.179 participated in this study among which 111(41.1%) were males and 159(58.9%) were females with the mean age of 30.22 ± 7.416 and 26.88 ± 4.620 respectively. Distribution of the respondents with respect to their specialties can be seen in Table 1. Among our respondents, 120(44.4%) were in academic practice, 65(24.1%) were in private practice and remaining were practicing both i-e. private and academic. (Table:1)
The use of the magnification in our study population was 76(28.1%), among which 67(24.8%) were using loupes and only 9(3.3%) of the respondents were using dental

Table 1: Demographics

176 respondents did not mention their specialty. (–) means no respondent

Figure 1

operating microscope. The prevalence of the rubber dam usage for isolation by the dentists was 110(40.7%). (Table:2) Among our study population the use of the Combination of digital/conventional radiography and electronic apex locator as a method of working length determination was 83(31.1%) and the use of Conventional/Digital radiography only was 161(59.6%). (Figure:1) Manual canal preparation technique was the most commonly used method of canal preparation practiced by 149(55.2%) followed by combination of manual and engine driven instruments by 66(24.4%), whereas only 41(15.2%) were using engine driven instruments as a preferred method

Table 2: Frequency of use of Magnification and Rubber dam

Table 3: Canal Preparation technique and method

of root canal preparation. Step-back technique was the most frequently used method of canal preparation used by 127(47%) of the dentists. (Table:3) The most commonly used engine driven instrument for preparation of root canal system was Protaper universal, preferred by 140(51.9%) of the dentists. (Figure:2) Among our study population, majority i.e. 201(74.4%) dentists reported for routine removal of smear layer. For smear layer removal the use of Sodium Hypochlorite
primarily after access opening was 68.5% with a mean concentration of 2.75±1.70. Almost fifty percent i.e.50.4%

Figure 2

of the dentists were using beveled needles for intracanal irrigation followed by side venting irrigation needles which were used by 26.3% of the respondents. Almost 50% of the respondents did not have any idea about the gauge of needle used for intracanal irrigation. When it was asked about the

Table 4: Cleaning of the Root Canal System

Table 5: Intracanal medicament and sealers

Figure 3

use of any adjuvants to increase the efficacy of the irrigants it was found that majority (45.2%) were not using any method to increase the efficacy of the irrigants whereas only 24.4% of the respondents reported to use manual activation method of irrigant activation. (Table:4) Two third of the practicing dentists i.e. 203(75.2%) were using calcium hydroxide as an intracanal medicament for achieving inter-appointment disinfection. Most commonly used root canal sealer was calcium hydroxide (52%) followed by Zinc Oxide Eugenol based sealers (33%). (Table:5) Lateral compaction (64.1%) was the preferred method of obturation. (Figure:3)

DISCUSSION

This study evaluated the trends in endodontic protocols amongst practicing dentists in Lahore. A sample from academic institutes and private practices was selected. The distribution of male to female dentists were 41.1% and 58.9% which is in accordance with the fact that the number of female dental surgeons is higher than males in Pakistan.11
The mean age of male to female dentists were 30.22±7.416 and 26.88±4.620 respectively. The majority of the respondents were below 30 years of age with their work experience of less than 10 years. With the establishment of many new private dental colleges in Pakistan a very large number of young practitioners are present.12 The use of rubber dam for isolation is integral in reducing microbial contamination, it decreases risks such as swallowing of instruments and medicaments, and thus increases the overall success rate of the endodontic treatment.
In this study, the percentage of dentists who used rubber dam routinely for isolation was 40.7%, which is similar to other surveys performed in different countries by Palmer 30.3%, Unal 5.1%, Bhatti 39.6% and Raoof 16%.1,2,13,14 Considering the current circumstances where COVID-19 pandemic has adversely affected the dentistry services, the use of rubber dam is very important for carrying out aerosol generating procedures in the dental office to reduce the risk
of cross contamination.15
Over the past few decades due to technological innovations in dentistry the benefits of the use of magnification during endodontic treatment cannot be ignored as it helps in location of missed canals, calcified canals and management of iatrogenic complications.16 Despite the proven advantages, in this study, 72% of the dentists did not use any means of magnification, 24.8% of the dentists were using loupes and only 3.3% were using endodontic microscope. The results are similar to a study done by Bhatti et al in which 78.3% of the practitioners do not use any magnification during root canal treatment.1
Determination of working length is a critical step during biomechanical preparation of root canals as inaccuracies during this stage can lead to treatment failure.17 The exact location of apical constriction is impossible to determine with conventional or digital radiographs alone because of its variation i.e. 1-3 mm from the radiographic apex. Electronic apex locators are a major paradigm shift in endodontics as they help in precise location of apical constriction.18 In this study, 59.6% of the dentists were using conventional/ digital radiographs alone whereas only 31.1% of the practicing dentists were using the Combination of digital/conventional radiography and electronic apex locator for determining of working length. These results are similar to studies conducted in Turkey, Iran, UK, USA by Unal et al, Raoof et al, Palmer et al , Lee at el where 77%, 71.3%, 57.3%, 52.5% were using conventional/digital radiographs alone whereas the percentage of dentists using
the combination of digital/conventional radiography and electronic apex locator were 12.8%, 35.7%, 34.5%, 8.9%.1,13,14,19
Root canal preparation is one of the key steps which has a major influence on the outcome of endodontic treatment. Various canal preparation techniques are used
during cleaning and shaping of the root canal system.20 One of the technological advances in endodontics is the introduction of engine driven file systems, which provides a well tapered canal with decreased procedural errors as compared to conventional root canal preparation techniques with stainless steel hand instruments.21 Although the use of different engine driven file systems in irregular canals or canals with morphological variations is still a matter of debate, however, they can be used in majority of the cases.20 Despite the proven advantages of engine driven systems, in the present study, most practicing dentists still used manual canal preparation with hand instruments as the preferred method of root canal preparation.
One of the findings of this study is that although 40% of our respondents used rubber dam in contrast to 15.2% pursuing engine driven systems for canal preparation. A possible explanation of this variation can be that most of the graduates were young dentists who recently graduatedand were under the direct and indirect supervision of their respective supervisors in teaching institutions where use of rubber dam is mandatory to follow the proper protocol of endodontics. However, because of inexperience the use of engine driven instruments for root canal preparation is limited.
Apical extrusion of debris and irrigant solutions is one of major causes of painful flare-ups which can affect the quality of life of the patients. Canal preparation method can play an important role in avoiding such unforeseen conditions. Various studies conducted in different parts of the world have shown crown down technique to be superior than step-back technique in terms of less generation of  stresses along the files, decreased extrusion of apical debris and irrigants.22 Nonetheless, almost half i.e. 47% of the dentists in our study were more inclined towards using stepback technique as a preferred method of canal preparation. Different type of engine driven instruments are available based on the design characteristics, rotating motion, torque and speed of use.21 The rotating motions used in these systems are rotation and reciprocation.23 After the advent of these systems, the use of continuous rotating motion became popular, however contemporary methods of root canal preparation involve reciprocation motion with a more user-friendly single file system.21,23 Regardless of the advantages of reciprocating systems, most commonly used system in our setting was Protaper Universal, which is a multi-file progressive taper rotary system.
During mechanical instrumentation of the root canal system, a layer of hard tissue debris known as smear layer is deposited along the root canal walls which prevents irrigants and intracanal medicaments to get rid of the microorganisms. There is consensus on this topic that complete chemo mechanical debridement including removal of smear layer is one of the major goals of endodontic treatment.24 Intracanal irrigation with 0.5-5.25% sodium hypochlorite is considered a gold standard antimicrobial agent to dissolve organic component of smear layer.25 In this study the use of sodium hypochlorite primarily after access opening was practiced by 68.5% of the dentists. The results are consistent with the findings of studies done by Palmer et al in UK who reported 75% and Unal et al in Turkey showed 73% of the dentists practiced use of sodium hypochlorite primarily after access opening.13,14
In contrast to this, a study conducted in Iran by Raoof et al showed 42.9% of the dentists using sodium hypochlorite whereas as 61.8% using normal saline for irrigation.2 These findings are further supported by studies done by Bhatti et al in Pakistan who reported 39.1% whereas Gaikwad et al in India showed only 12.5% of the dentists using sodium hypochlorite and 53% using combination of sodium hypochlorite and normal saline.1,26
The aim to achieve 3-dimensional cleaning of the root canal space is not possible without irrigation solution reaching the apical one third of the working length followed by activation of irrigant with different activation methods as areas like isthmuses, apical deltas etc are not negotiable even with modern canal preparation methods.25 In this survey 45.2% of the dentists were not using any irrigant activation method to increase the efficacy of irrigant whereas only 24.4 % used manual method of irrigant activation.
With growing evidence, it has become evident that irrigant activation with ultrasonics, sonic activation, or negative pressure devices is very important for irrigant penetration in to the apical one third of the canal for achieving maximum disinfection of the canal.25,27 Direct irrigation of the canal with positive pressure
irrigation needles is one of the most commonly used irrigation methods taught in undergraduate schools. For routine endodontic procedures a 27G needle placed 3 mm from the apex of a canal prepared is sufficient.24 45.9% of the respondents showed missing response when they were asked about the needle gauge representing the practicing dentists have lack of knowledge making the answer of this question invalid .New studies should be conducted to find answer to this question.
Calcium hydroxide is considered as a gold standard intracanal medicament to achieve and maintain interappointment disinfection.28 In this study 75.2% of the
respondents used Calcium hydroxide as intracanal medicament. This is consistent with the findings of other studies by Bhatti et al 67.2%, Unal et al 53%, Palmer et al 60%.1,13,14 In contrast a study by Iqbal et al showed that 55 % of the dentists using formocresol whereas only 5% using calcium hydroxide as intracanal medicament.29 The main purpose of root canal obturation is to provide three dimensional corono-apical seal of the root canal system to impede the traffic of saliva, bacteria and their virulence and other irritating factors which could lead to post treatment disease. Various methods of root canal obturation are being used for this.30
In this study the most common method of obturation was lateral condensation done by 64.1% of the dentists followed by single cone obturation done by 23% of the
dentists. The results are consistent with the studies done by Gaikwind et al and Azhar et al in which 78.2% and 81% of the practicing dentists were using lateral condensation as a method to achieve three dimensional obturation of the root canal system.26,29
In this study most commonly used root canal sealer was calcium hydroxide (52%) followed by Zinc Oxide Eugenol based sealers (33%). These findings are contradictory with the findings of studies done by Lee et al in USA in which Zinc oxide eugenol sealer was used by 74.6 % of the dentists.19 Study done by Palmer et al in UK also showed that 56% of the dentists using Zinc oxide eugenol as a root canal sealer.13

CONCLUSION

This study has shown that there are many shortcomings and gaps in the endodontic protocols followed by most of the dentists in Lahore. This study highlights the need for updating their knowledge and practices. This can eventually become a basis to suggest a standardized treatment guideline.

LIMITATIONS

Most of the sample size consisted of young dentists who are at the start of their career and may be cannot afford the use of expensive gadgets i.e. Magnification devices; apex locators; digital periapical radiographs and rotary instrumentation etc.

RECOMMENDATIONS

These shortcomings should be addressed by the governing dental bodies and faculties at the institutional level and continuing dental education modules should be made compulsory for all general practitioners. Provision of handson courses by the endodontists can be of greater value in this technically challenging field.

ACKNOWLEDGEMENT

The authors wish to acknowledge the support of Miss. Afshan Khanum from Department of Biostatistics, FMH College of Medicine & Dentistry, Lahore, Pakistan, for helping in data analysis on SPSS.

CONFLICT OF INTEREST

None to declare

FINANCIAL DISCLOSURE

None to disclose

REFERENCES

  1. Bhatti UA, Qureshi B, Azam S. Trends in Contemporary Endodontic Practice of Pakistan: A National Survey. J Pak Dent Assoc. 2018;27:50-7. https://doi.org/10.25301/JPDA.272.50
  2. Raoof M, Heidaripour M, Shahravan A, Haghani J, Afkham A, Razifar M, et al. General dental practitioners’ concept towards using radiography and apex-locators in endodontics. Iran Endod J. 2014;9:277.
  3. root canal treatment reconsidered. Dent Traumatol. 1998;14: 1-9. https://doi.org/10.1111/j.1600-9657.1998.tb00801.x
  4. Akhlaghi N, Nourbakhsh N, Khademi A, Karimi L. General dental practitioners’ knowledge about the emergency management of dental trauma. Iran Endod J.2014;9:251.
  5. Weisleder R, Yamauchi S, Caplan DJ, Trope M, Teixeira FB. The validity of pulp testing: a clinical study. J Am Dent Assoc.2009;140:1013-7. https://doi.org/10.14219/jada.archive.2009.0312
  6. Kaufman AY. An enigmatic sinus tract origin. DENT TRAUMATOL.1989;5:159-61. https://doi.org/10.1111/j.1600-9657.1989.tb00353.x
  7. Loest C. Quality guidelines for endodontic treatment: consensus report of the Eur Soci Endodontol. Int Endod J. 2006;39:921-30. https://doi.org/10.1111/j.1365-2591.2006.01180.x
  8. Sjögren U, Hägglund B, Sundqvist G, Wing K. Factors affecting the long-term results of endodontic treatment. J Endod. 1990;16:498 504.
    https://doi.org/10.1016/S0099-2399(07)80180-4
  9. Eriksen HM. Endodontology-epidemiologic considerations. DENT TRAUMATOL. 1991;7:189-95. https://doi.org/10.1111/j.1600-9657.1991.tb00434.x
  10. Kohli A, Singh S, Podar R, Dadu S, Kulkarni G. A comparative evaluation of endodontic practice trends in India:” The Mumbai study”. Indian J Dent Sci. 2014;25:729. https://doi.org/10.4103/0970-9290.152179
  11. Ghaffar A, Zaidi S, Qureshi H, Hafeez A. Medical education and research in Pakistan. Lancet. 2013;381(9885):2234-6. https://doi.org/10.1016/S0140-6736(13)60146-4
  12. Jawaid SA. Plight of Dentistry in Pakistan. Pak J Med Sci Q. 2020;36:299. https://doi.org/10.12669/pjms.36.3.2278
  13. Palmer N, Ahmed M, Grieveson B. An investigation of current endodontic practice and training needs in primary care in the north west of England. Br Dent J. 2009;206(11):E22-E. https://doi.org/10.1038/sj.bdj.2009.473
  14. Unal GC, Kaya BU, Tac AG, Kececi AD. Survey of attitudes, materials and methods preferred in root canal therapy by general dental practice in Turkey: Part 1. Eur J Dent. 2012;6:376. https://doi.org/10.1055/s-0039-1698975
  15. Clarkson J, Ramsay C, Aceves M, Brazzelli M, Colloc T, Dave M, et al. Recommendations for the re-opening of dental services: a rapid review of international sources. 2020.
  16. Carr GB, Murgel CA. The use of the operating microscope in endodontics. Dent Clin N Am. 2010;54:191-214. https://doi.org/10.1016/j.cden.2010.01.002
  17. Darcey J, Taylor C, Roudsari RV, Jawad S, Hunter M. Modern endodontic principles part 3: preparation. Dent Update. 2015;42:810-22. https://doi.org/10.12968/denu.2015.42.9.810
  18. Gordon M, Chandler N. Electronic apex locators. Int Endodo J. 2004;37:425-37. https://doi.org/10.1111/j.1365-2591.2004.00835.x
  19. Lee M, Winkler J, Hartwell G, Stewart J, Caine R. Current trends in endodontic practice: emergency t reatments and technological armamentarium. J Endod. 2009;35:35-9. https://doi.org/10.1016/j.joen.2008.10.007
  20. Shantiaee Y, Dianat O, Mosayebi G, Namdari M, Tordik P. Effect of root canal preparation techniques on crack formation in root dentin. J Endod. 2019;45:447-52. https://doi.org/10.1016/j.joen.2018.12.018
  21. Tomson PL, Simon SR. Contemporary cleaning and shaping of the root canal system. Prim Dent J. 2016;5:46-53.
  22. Mittal R, Singla MG, Garg A, Dhawan A. A comparison of apical bacterial extrusion in manual, ProTaper rotary, and one shape rotary instrumentation techniques. J Endod. 2015;41:2040-4. https://doi.org/10.1016/j.joen.2015.09.002
  23. Christofzik D, Bartols A, Faheem MK, Schroeter D, GroessnerSchreiber B, Doerfer CE. Shaping ability of four root canal instrumentation systems in simulated 3D-printed root canal models. PLoS One. 2018;13(8):e0201129. https://doi.org/10.1371/journal.pone.0201129
  24. Darcey J, Jawad S, Taylor C, Roudsari RV, Hunter M. Modern endodontic principles part 4: irrigation. Dent Update. 2016;43:20-33. https://doi.org/10.12968/denu.2016.43.1.20
  25. Neelakantan P, Ounsi HF, Devaraj S, Cheung GS, Grandini S. Effectiveness of irrigation strategies on the removal of the smear layer from root canal dentin. Odontology. 2019;107:142-9. https://doi.org/10.1007/s10266-018-0373-2
  26. Gaikwad A, Jain D, Rane P, Bhondwe S, Taur S, Doshi S. Attitude of general dental practitioners toward root canal treatment procedures in India. J Contemp Dent Pract. 2013;14:528-31. https://doi.org/10.5005/jp-journals-10024-1356
  27. Galler K, Grubmüller V, Schlichting R, Widbiller M, Eidt A, Schuller C, et al. Penetration depth of irrigants into root dentine after sonic, ultrasonic and photoacoustic activation. Int Endod J. 2019;52:1210-7. https://doi.org/10.1111/iej.13108
  28. Gluskin AH, Lai G, Peters CI, Peters OA. The double-edged sword of calcium hydroxide in endodontics: Precautions and preventive strategies for extrusion injuries into neurovascular anatomy. J Am Dent Assoc. 2020. https://doi.org/10.1016/j.adaj.2020.01.026
  29. Iqbal A, Akbar I, Qureshi B, Sghaireen MG, AL-Omiri MK. A survey of standard protocols for endodontic treatment in north of KSA. Int Sch Res Notices. 2014;2014. https://doi.org/10.1155/2014/865780
  30. Darcey J, Roudsari RV, Jawad S, Taylor C, Hunter M. Modern endodontic principles part 5: obturation. Dent Update. 2016;43:114-29. https://doi.org/10.12968/denu.2016.43.2.114

  1. Postgraduate Resident, Department of Operative Dentistry, FMH College of Medicine & Dentistry, Lahore, Pakistan.
  2. Associate Professor, Department of Operative Dentistry, FMH College of Medicine & Dentistry, Lahore, Pakistan.
  3. Associate Professor, Department of Operative Dentistry, FMH College of Medicine & Dentistry, Lahore, Pakistan.
  4. Professor, Department of Operative Dentistry, CMH Lahore Medical & Dental College, Lahore, Pakistan.
    Corresponding author: “Dr. Saood Khan Lodhi ” < ssaoodkhan496@gmail.com >

 

Trends in Endodontic Protocols Amongst Dentists in Lahore

Saood Khan Lodhi                                BDS

Saroosh Ehsan                                       BDS, FCPS

Adeela Rafique                                      BDS, MSc

Muhammad Nasir Saleem                BDS, FCPS, MSc

OBJECTIVES: To determine the trends in endodontic protocols amongst practicing dentists in teaching institutions and private clinics in Lahore.
METHODOLOGY:
A cross sectional survey was conducted amongst dentists working in the teaching institutions and in the private clinics of Lahore. A pre-piloted questionnaire survey adopted from Kohli et al with slight modifications was used. In this descriptive study 270 practicing dentists were selected using consecutive sampling with a 5% level of significance and margin of error.
RESULTS:
The 270 respondents had a mean age of 28.16 ± 6.18 participated in this study among which 111 (41.1%) were males and 159(58.9%) were females with the mean age of 30.28 ± 7.416 and 26.68 ± 4.62 respectively (12.2%) were consultants, 175(64.8%) were general dentists whereas 62(23%) were postgraduate residents. In our study population, 76(28.1%) dentists were using magnification among which 67(88.2%) were using loupes and 9(11.8%) were using microscope. The prevalence of the rubber dam usage for isolation among our respondents was 110(40.7%) only, 201(74.4%) dentists reported for routine removal of smear layer. Manual canal preparation technique was the most commonly used method practiced by 149(55.2%) dentists. 136(50.4%) dentists were using beveled needles for irrigation, whereas only 71(26.3%) were using side venting irrigation needles. Majority of the dentists (45.2%) were not using any method to increase the efficacy of the irrigants.
CONCLUSION:
There are deficiencies in the endodontic protocols followed by majority of the dentists in Lahore and these short comings should be addressed by governing bodies.
KEYWORDS:
Root canal therapy, Endodontic, Practice Patterns, Dentists
HOW TO CITE:
Lodhi Sk, Ehsan S, Rafique A, Saleem MN. Trends in endodontic protocols amongst dentists in Lahore. J Pak Dent Assoc 2020;29(4):239-245.
DOI:
https://doi.org/10.25301/JPDA.294.239
Received:
30 July 2020, Accepted: 08 September 2020
Download PDF

Determination of Minimum Inhibitory and Fungicidal Concentrations of Potash Alum Against Clinical Isolates of Candida albicans

Muhammad Irshad                                 PhD

Muhamamd Younas                               FCPS

Asif Ullah Qureshi                                   FDS

Amir Hameed                                           MPH

OBJECTIVE: Candida albicans is an opportunistic pathogen causing oral candidiasis. Commercially available antifungal agents are effective in eliminating C. albicans, however, their toxicity and high cost are undesirable. Potash Alum is a naturally occurring salt with antibacterial and antifungal properties. Therefore, Potash Alum may be effective against C. albicans. Objective: The main objective of this study was to investigate the in vitro susceptibility of C. albicans to Potash Alum.
METHODOLOGY:
Swab samples from 19 patients attending the Oral medicine department of Rehman College of Dentistry were transferred to tubes containing Sabouraud Dextrose Broth. After identification of C. albicans by Gram-staining, a solution of 2-5 x 105 CFUs/mL C. albicans was prepared and subjected to MIC and MFC determination by the standard broth microdilution method. Potash alum concentrations of 5, 10 and 20 mg/mL were used. Commercially available Nystatin was used as a positive control.
RESULTS:
Our results showed that 10 mg/mL of Potash Alum (PA) solution was able to inhibit growth of most of the clinical isolates of C. albicans. In 5 samples, even 5mg/mL was effective in inhibiting the growth of C. albicans. Potash alum demonstrated fungistatic rather than a fungicidal action against C. albicans.
CONCLUSIONS:
It is concluded that potash alum has a fungistatic action against C. albicans in vitro. In addition, the optimum in vitro concentration of potash alum solution effective in inhibiting growth of C. albicans was found to be 10mg/mL.
KEYWORDS:
Candida albicans, potash alum, nystatin, antifungal
HOW TO CITE:
Irshad M, Younas M, Qureshi AU, Hameed A. Determination of minimum inhibitory and fungicidal concentrations of potash alum against clinical isolates of candida albicans. J Pak Dent Assoc 2020;29(4):235-238.
DOI:
https://doi.org/10.25301/JPDA.294.235
Received:
25 July 2020, Accepted: 04 September 2020

INTRODUCTION

Oral candidiasis (OC) is one of the most common fungal infections of oral cavity.1 It is an opportunistic infection which most commonly affects elderly, debilitated, and immunocompromised patients.1 Candida albicans (C. albicans) is a commensal found in oral cavity and is a part of gut microbiota and it is one of the most
common opportunistic pathogen associated with OC.2 Dentures provide an ideal intraoral microenvironment for the growth of C. albicans and denture wearers are therefore, at a higher risk of developing OC. Suboptimal oral and denture hygiene contributes towards growth of C. albicans.2 Factors such as biofilm formation and proteolytic enzymes help C. albicans to establish a successful intraoral infection.1
Treatment options for OC are usually limited to commercially available antifungal agents.3 Most commonly, it is treated with antifungal agents such as Nystatin, Amphotericin B and Fluconazole among others.3 However, controversial results were seen with these commercial agents as toxicity is one of the main concerns about some of these antifungal agents.4 Others are either expensive or have an unpleasant taste. Development of antifungal resistance, particularly in the developing world, is another concern which has been on the rise due to overuse of these antifungal agents.5
Resistance to antifungal agents can result from their indiscriminate and widespread use in the developing world. Therefore, newer, safer, and cost-effective antifungal agents should be explored.
Potash Alum (KAl(SO4)2·12H2O) is a naturally occurring compound with antibacterial and antifungal properties.6 Potash Alum (PA) has been in use of Egyptian, Indian and Chinese civilizations since antiquity.7 It is known by the name of Phitkary in the subcontinent and is a household item. PA is odourless, cheap, and nontoxic in small quantities. Due to its lack of toxicity, the United States, Food and Drug Administration (FDA) has approved it as a food additive.8
The antibacterial and antifungal properties of PA have been reported earlier.6 We hypothesized that due to the antifungal properties of PA, it can be effective against C. albicans and therefore can be used as a cheap and easily available alternative to commercially available antifungal agents. Studies reporting on the antifungal properties of PA are scarce and often inconclusive.9
Minimum inhibitory and fungicidal concentrations (MIC & MFC) of PA against C. albicans have not been reported earlier. Therefore, the aim of this study was to investigate the in vitro susceptibility of C. albicans to Potash Alum by MIC and MFC determination.

METHODOLOGY

This quasi-experimental study was approved from the institutional ethical committee under EC (Ref. No. RCD19-05-016). The study was carried out at the oral pathology laboratory of Rehman College of Dentistry, Peshawar during the period of May till August 2019. Patients who had used antifungal agents in the past 3 months were excluded from the study. Nineteen patients attending the oral medicine department of Rehman College of Dentistry, were sampled using convenience sampling technique, with 2 moistened sterile swabs from the hard palate and base of the prosthesis. These swabs were then added to test tubes containing Sabouraud Dextrose Broth (SDA, Difco Laboratories, France) for transfer to the laboratory. The collected samples were inoculated into 15 × 90mm disposable Petri dishes containing SDA (Difco Laboratories, USA/France), in the presence of 100µg/mL chloramphenicol (Sigma-Aldrich, St. Louis, MO, USA). After incubation at 37°C for 48 hours, C. albicans was Gram stained observed under light microscope. Observation of fungal hyphae confirmed presence of C. albicans.
C. albicans suspensions were prepared in tubes containing 5 mL of phosphate buffered saline (PBS) solution. The suspensions were vortexed for 2 mins and adjusted to 2-5 x 105 CFUs/mL with the help of a haemocytometer.
Minimum Inhibitory and Fungicidal Concentrations (MIC and MFC). Standard broth microdilution method was used to

Table 1: Results of MIC and MFC estimation of Potash Alum on C. albicans.

NA: Not Available; +: growth of microorganism; -: without microorganism growth

determine the minimum inhibitory concentration (MIC) of PA and nystatin against clinical strains of C. albicans.10 Experiments were performed in triplicate, in sterile, 96-well microplates. PA solution was prepared in sterile PBS and serially diluted to 5, 10 and 20 mg/mL. Commercially available Nystatin 20 mg/mL (Wyeth Pharmaceuticals, Karachi, Pakistan) was acquired from the market. We added 100µL of Sabouraud Dextrose Broth to each well of a plate. Next, 100µL of various concentrations (5, 10 and 20 mg/mL) of PA and Nystatin (positive control) were added to the respective wells. Sterile PBS was used as negative control. 10µL of the C. albicans inoculum containing 2-5 x 105 CFUs/mL was added to each well. Viability controls were carried out on the clinical isolates of C. albicans under the same
conditions. The plates were wrap-sealed and incubated at 37°C for 48h. The lowest concentrations of PA which visually inhibited growth of C. albicans in the wells was The MICs of PA and Nystatin were taken as the lowest concentrations capable of visually inhibiting the C. albicans growth in the wells, when compared to the growth under control conditions.
After determination of the MIC, 10µl of the supernatant from the wells were plated on SDA, and incubated at 37°C for 48?h. The MFC was defined as the lowest concentration of PA that either completely inhibited growth of C. albicans or showed growth of fewer than three colonies. All experiments were carried out in triplicate. The MFC/MIC ratio was also calculated. Data was analysed using Microsoft Excel 2016.

RESULTS

We used 5, 10 and 20 mg/mL of PA to evaluate its antifungal activity. C. albicans samples of 19 denture wearing patients were used in this study. Patients included 12 males and 7 females, and the mean age of patients was 63 + 9 years. None of the patients was a current smoker. Our results show that 10 mg/mL of Potash Alum (PA) was able to inhibit growth of most of the clinical isolates of C. albicans. In 5 samples, even 5mg/mL was effective in inhibiting the growth of C. albicans. 10mg/mL was therefore determined to be the MIC value of PA against C. albicans. Growth of the C. albicans colonies was observed on culture media even after treatment with 20 mg/mL of PA in most cases. PA showed fungicidal activity only against 5 clinical isolates. PA was therefore, fungistatic rather than fungicidal in the case of most clinical isolates of C. albicans.

DISCUSSION

In our study Potash Alum (PA) showed fungistatic activity at 10 mg/mL concentrations against the majority of C. albicans clinical strains. Only in 5 out of 19 samples, PA was able to completely eradicate C. albicans and thus showed fungicidal activity. We used commercially available Nystatin as a positive control in our study, which is a known fungicidal agent. Nystatin is effective in the treatment of OC11; however, its nephrotoxic potential is well established and is a point of concern for its use in patients with comorbid conditions.12 Nephrotoxic and hepatotoxic effects of other antifungal agents used in OC have also been reported.13 Antibacterial activity of PA on oral microbiota has been reported earlier.14,15 Due to its antibacterial effects PA improves periodontal health in chronic periodontitis when used as a mouth rinse.16
Human studies about antifungal activity of PA are scarce and these studies are mostly conducted on species other than C. albicans17 Shalli et al18 studied antifungal properties of PA on vaginal microflora including C. albicans and found it an effective antifungal agent against C. albicans. Studies on the MIC and MFC values of PA against C. albicans are scarce. We found that MIC of PA for C. albicans is 10mg/mL, which is consistent with another study19 where the values were reported as 20% w/v, roughly equal to our reported values. Mechanism of antimicrobial action of PA is not clear, however, it is proposed that the formation of alum ions react with free protein and thiol group molecules on the surface of microbes, resulting in protein precipitation.20
The protein precipitation by PA may also partly explain its fungistatic rather than fungicidal action. Further studies are needed to elaborate on the pharmacodynamics of antimicrobial/antifungal action of PA. Due to its easy availability and cheap cost, PA is used in a variety of applications. Its easy accessibility and global acceptability makes it an ideal antifungal agent for oral candidiasis. In addition, it has a good safety profile and milder taste than most commercially available antifungal agents.21 Its widespread use as a food additive and as an adjuvant in human vaccines further consolidates its lack of toxicity.22 Although, our study has shown efficacy of PA against C. albicans in vitro, however, conditions in the oral cavity are much different from those in the laboratory. Therefore, further clinical studies are needed to elucidate the role of PA in treatment of Oral Candidiasis.

CONCLUSION

We conclude that potash alum has a fungistatic action against C. albicans in vitro. In addition, the optimum in vitro concentration of potash alum effective in inhibiting growth of C. albicans was found to be 10mg/mL. Since this study has been conducted on patient samples from a region, these results should be interpreted with caution when generalizations are made. For generalization of our results, further large scale in vivo and in vitro studies are needed. Based on our results and its safety profile, we recommend that general dental practitioners may recommend Potash alum solution as an alternative to commercially available antifungal agents for the treatment of oral candidiasis.

ACKNOWLEDGEMENT

We thank the technical and support staff of Oral pathology laboratory for their help throughout the research project.

CONFLICT OF INTEREST STATEMENT

The authors declare that there is no conflict of interest involved in this study

SOURCE OF FUNDING

The project was completely self-funded and no external funding was obtained or utilized for this research.

REFERENCES

  1. Bhattacharjee P. Epidemiology and antifungal susceptibility of Candida species in a tertiary care hospital, Kolkata, India. Current Medi Mycol. 2016;2:20-7.
    https://doi.org/10.18869/acadpub.cmm.2.2.5
  2. Bianchi CM, Bianchi HA, Tadano T, PAULA CR, Hoffmann-Santos HD, Leite Jr DP, Hahn RC. Factors related to oral candidiasis in elderly users and non-users of removable dental prostheses. Revista do Instituto de Medicina Tropical de São Paulo. 2016;58-7. https://doi.org/10.1590/S1678-9946201658017
  3. Seleem D, Benso B, Noguti J, Pardi V, Murata RM. In vitro and in vivo antifungal activity of lichochalcone-A against Candida albicans biofilms. PLoS One. 2016 10;11(6): e0157188. https://doi.org/10.1371/journal.pone.0157188
  4. Pappas PG, Kauffman CA, Andes DR, Clancy CJ, Marr KA, Ostrosky-Zeichner L, Reboli AC, Schuster MG, Vazquez JA, Walsh TJ, Zaoutis TE. Clinical practice guideline for the management of candidiasis: 2016 update by the Infectious Diseases Soci Am. Clini Infect Dis. 2016.15;62(4):e1-50. https://doi.org/10.1093/cid/civ1194
  5. Pearse MJ. Historical use and future development of chemicals for solid-liquid separation in the mineral processing industry. Minerals Engi. 2003. 1;16:103-8.
    https://doi.org/10.1016/S0892-6875(02)00288-1
  6. Menotti J, Alanio A, Sturny-Leclère A, Vitry S, Sauvage F, Barratt G, Bretagne S. A cell impedance-based real-time in vitro assay to assess the toxicity of amphotericin B formulations. Toxicol Appl Pharmacol. 2017. 1;334:18-23. https://doi.org/10.1016/j.taap.2017.08.017
  7. Chandra J, Mukherjee PK, Leidich SD, Faddoul FF, Hoyer LL, Douglas LJ, Ghannoum MA. Antifungal resistance of candidal biofilms formed on denture acrylic in vitro. J Dent Res. 2001;80:903-8. https://doi.org/10.1177/00220345010800031101
  8. Winter R. A consumer’s dictionary of food additives: Descriptions in plain English of more than 12,000 ingredients both harmful and desirable found in foods. Crown Archetype; 2009 14.
  9. Olmez A, Can H, Ayhan H, Okur H. Effect of an alum-containing mouthrinse in children for plaque and salivary levels of selected oral microflora. J Clin Pediatr Dentis. 1998;22:335-40.
  10. Hadacek F, Greger H. Testing of antifungal natural products: methodologies, comparability of results and assay choice. Phytochemical Analysis: Int J Plant Chemi Biochem Tech. 2000;11:137-47. https://doi.org/10.1002/(SICI)1099-1565(200005/06)11:3<137::AIDPCA514>3.0.CO;2-I
  11. Lyu X, Zhao C, Yan ZM, Hua H. Efficacy of nystatin for the treatment of oral candidiasis: a systematic review and meta-analysis. Drug Design, Development Ther 2016;10:1161. https://doi.org/10.2147/DDDT.S100795
  12. Tverdek FP, Kofteridis D, Kontoyiannis DP. Antifungal agents and liver toxicity: a complex interaction. Expert revi anti-infect Ther. 2016. 2;14:765-76. https://doi.org/10.1080/14787210.2016.1199272
  13. Groll AH, Petraitis V, Petraitiene R, Field-Ridley A, Calendario M, Bacher J, Piscitelli SC, Walsh TJ. Safety and efficacy of multilamellar liposomal nystatin against disseminated candidiasis in persistently neutropenic rabbits. Antimicrobial Agents Chemother. 1999 1;43:
    2463-7. https://doi.org/10.1128/AAC.43.10.2463
  14. Rupesh S, Winnier JJ, Nayak UA, Rao AP, Reddy NV. Comparative evaluation of the effects of an alum-containing mouthrinse and a saturated saline rinse on the salivary levels of Streptococcus mutans. J Indian Soci Pedodont Prevent Dentis. 2010 1;28:138. https://doi.org/10.4103/0970-4388.73780
  15. Mohammad HH. In vitro antibacterial activity of propolis, alum, miswak, green and black tea, cloves extracts against Porphyromonas gingivalis isolated from perio-dontitis patients in Hilla City, Iraq. Amer J Phytomed Clin Therap. 2013;1:140-8.
  16. Hussein AA. The effects of different concentration of Alum solutions on plaque and bleeding levels. J Pharmaceut Scie Res. 2019 1;11:1078-81.
  17. Kumar GS, Kumaresan S. Potash Alum [KAl (SO. Current Chemistry. 2012;3:91.
  18. Shalli FG, Taufikurohmah T, Apriyosa E. Preliminary Studies ON Antifungal and Antibacterial Activity of Alum as Medicine Preparation for Vaginal Discharge. Int J Res-Granthaalayah. 2020 9;8:188-95. https://doi.org/10.29121/granthaalayah.v8.i6.2020.464
  19. Nadkarni P, Vasudevan R, Almeamar H, Fawzi N. Antibacterial activity of aluminum potassium sulfate and syzygium aromaticum extract against pathogenic microorganisms. Inter J Fertility Sterility. 2020;13:315-23.
  20. National Center for Biotechnology Information. PubChem Database. Aluminum potassium sulfate, CID=24856, https://pubchem.ncbi.nlm.nih.gov/compound/Aluminum-potassiumsulfate (accessed on July 25, 2020)
  21. Westerman ME, Boorjian SA, Linder BJ. Safety and efficacy of intravesical alum for intractable hemorrhagic cystitis: a contemporary evaluation. Int Braz J Urol. 2016;42:1144-9. https://doi.org/10.1590/s1677-5538.ibju.2015.0588
  22. Doherty TM, Andersen P. Vaccines for tuberculosis: novel conceptsm and recent progress. Clin Microbiol Revi. 2005 1;18:687-702. https://doi.org/10.1128/CMR.18.4.687-702.2005

  1. Associate Professor and HoD, Department of Oral Pathology, Rehman College of Dentistry, Peshawar.
  2. Assistant Professor, Department of Oral Medicine, Peshawar Dental College, Peshawar.
  3. Assistant Professor, Department of Oral Medicine, Rehman College of Dentistry, Peshawar.
  4. Assistant Professor, Department of Community Dentistry, Peshawar Dental College, Peshawar.
    Corresponding author: “Dr. Muhammad Irshad” < drirshad@live.nl >

Determination of Minimum Inhibitory and Fungicidal Concentrations of Potash Alum Against Clinical Isolates of Candida albicans

Muhammad Irshad                                 PhD

Muhamamd Younas                               FCPS

Asif Ullah Qureshi                                   FDS

Amir Hameed                                           MPH

OBJECTIVE: Candida albicans is an opportunistic pathogen causing oral candidiasis. Commercially available antifungal agents are effective in eliminating C. albicans, however, their toxicity and high cost are undesirable. Potash Alum is a naturally occurring salt with antibacterial and antifungal properties. Therefore, Potash Alum may be effective against C. albicans. Objective: The main objective of this study was to investigate the in vitro susceptibility of C. albicans to Potash Alum.
METHODOLOGY:
Swab samples from 19 patients attending the Oral medicine department of Rehman College of Dentistry were transferred to tubes containing Sabouraud Dextrose Broth. After identification of C. albicans by Gram-staining, a solution of 2-5 x 105 CFUs/mL C. albicans was prepared and subjected to MIC and MFC determination by the standard broth microdilution method. Potash alum concentrations of 5, 10 and 20 mg/mL were used. Commercially available Nystatin was used as a positive control.
RESULTS:
Our results showed that 10 mg/mL of Potash Alum (PA) solution was able to inhibit growth of most of the clinical isolates of C. albicans. In 5 samples, even 5mg/mL was effective in inhibiting the growth of C. albicans. Potash alum demonstrated fungistatic rather than a fungicidal action against C. albicans.
CONCLUSIONS:
It is concluded that potash alum has a fungistatic action against C. albicans in vitro. In addition, the optimum in vitro concentration of potash alum solution effective in inhibiting growth of C. albicans was found to be 10mg/mL.
KEYWORDS:
Candida albicans, potash alum, nystatin, antifungal
HOW TO CITE:
Irshad M, Younas M, Qureshi AU, Hameed A. Determination of minimum inhibitory and fungicidal concentrations of potash alum against clinical isolates of candida albicans. J Pak Dent Assoc 2020;29(4):235-238.
DOI:
https://doi.org/10.25301/JPDA.294.235
Received:
25 July 2020, Accepted: 04 September 2020
Download PDF

Frequency of HPV-16 in Saliva and Blood in Head and Neck Squamous Cell Carcinoma in Pakistani Population

Saima Saher                                      M,Phil

Sofia Ali Syed                                   BDS, M.Phil

Asifa Iqbal                                         BDS, M.Phil

Faryal Ali Syed                                 BDS

Faiza Amin                                        BDS, MDS

Aneesa Sultan                                  PhD

Mariam Anees                                  PhD

OBJECTIVE: Pakistan is geographically located in the region where prevalence of head and neck squamous cell carcinoma (HNSCC) is high. Human papilloma virus (HPV) subtype-16 plays significant role in heterogeneity of HNSCC. The objective of this study was to evaluate the frequency of HPV-16 in both blood and saliva in HNSCC in our population and its association with clinicopathological features.
METHODOLOGY:
A total of 200 samples comprising 100 blood and 100 saliva samples were collected. Hundred samples (saliva; n=50, blood; n=50) were collected from histopathologically confirmed head and neck squamous cell carcinoma patients and 100 samples (saliva; n=50 saliva, blood; n=50) were collected from healthy individuals without a history of cancer as controls. HPV-16 was detected using conventional polymerase chain reaction and gel-electrophoresis. The frequency and distribution of clinicopathological variables were calculated in percentages. Chi-square test was used to analyze the association of HPV-16 positivity with clinicopathological variables.
RESULTS:
Of 100 samples from HNSCC patients, 11 (11%) samples were positive for HPV-16. Of 11 HPV-16 positive samples, 8 (16%) were detected in saliva (n=50) and 3 (6%) were detected in plasma (n=50). Of 100 samples from control group, both blood and saliva samples were negative for HPV-16. No statistically significant association was found between HPV-16 in saliva and blood and clinicopathological characteristics (P > 0.05).
CONCLUSION:
Within the limit of current study, HPV-16 has a low-frequency in saliva and blood in HNSCC in our population. Further studies on HNSCC with large sample and HPV-subtypes are suggested.
KEYWORD:
Blood; human papilloma virus; saliva; squamous cell carcinoma.
HOW TO CITE:
Saher S, Syed SA, Iqbal A, Syed FA, Amin F, Sultan A, Anees M. Frequency of HPV-16 in saliva and blood in head and neck squamous cell carcinoma in Pakistani population. J Pak Dent Assoc 2020;29(4):228-234.
DOI:
https://doi.org/10.25301/JPDA.294.228
Received:
07 August 2020, Accepted: 03 September 2020

INTRODUCTION

Head and neck squamous cell carcinoma (HNSCC) is the seventh most common malignancy across the globe.1 It accounts for 3 % of all cancers and arises from epithelial lining of the oral and nasal cavity, pharynx, larynx, paranasal sinuses, salivary glands, and lymph nodes. Histopathologically, about 95 % of head and neck cancers are squamous cell carcinoma (SCC).2 Pakistan, a developing country with many health-related challenges to its population, is geographically located in the region where prevalence of HNSCC is high.3,4 Tobacco and alcohol are the major risk-factors that contribute to the development of HNSCC in developing countries. Emerging evidence suggests role of human papilloma virus (HPV) infection in the heterogeneity of HNSCC particularly in developed countries.5,6 Moreover, the prevalence of HPV-driven HNSCC varies geographically across the globe.7 The HPV-driven HNSCC differs significantly from the HPV negative HNSCC, in terms of the molecular, therapeutic and prognostic aspects. Therefore, it is essential to discriminate between HPV-positive and HPV-negative HNSCC.5 Recently, a systematic review reported a high prevalence of HPV subtype 16 in HNSCC in Bangladesh, India and Pakistan.8 High-risk (HR) HPV subtypes 16 and 18 have potential to transform epithelial cells which are derived from anogenital region. The transforming potential of HR-HPV is mainly due to the viral oncoproteins, E6 and E7, that deactivate tumor-suppressor proteins, p53 and pRb respectively. Expression of HR-HPV E6 and E7 causes cellular proliferation, dysregulated cell cycle, increased mutation and chromosomal instability.5
Minimally or non-invasive liquid biopsies including blood, cerebrospinal fluid, saliva and urine have recently gained much attention for diagnostic and prognostic purpose
in HNSCC.9 Despite the fact that the presence of HPV-16 in HNSCC is site-specific, studies have utilized either tumor tissue, saliva or plasma for HPV detection.5 While local
data on HR-HPV-16 in the subsets of HNSCC including oral/oropharyngeal squamous cell carcinoma are available, data on HNSCC including all subsites are lacking. Moreover,
data comparing blood and saliva for the presence of HPV-16 site-specificity in HNSCC are scarce. Therefore, we aimed to evaluate the frequency of HPV-16 in both blood and saliva in HNSCC in our population and also investigated its association with clinicopathological features.

METHODOLOGY

This observational study was conducted between September 2018 to August 2019 in Cancer Genetics and Molecular Cancer Therapeutics Lab at Quaid-i-Azam University Islamabad after approval from Institutional review board (IRB-QAU-170). A total of 200 samples comprising 100 blood and 100 saliva samples were collected. Of 200 samples, 100 samples (saliva, n = 50; blood, n = 50) were collected from 50 histopathologically confirmed head and neck squamous cell carcinoma patients who were admitted for surgical treatment at Pakistan Institute of Medical Sciences (PIMS), Islamabad. The rest of the 100 samples (saliva, n = 50, blood, n = 50) were collected from 50 healthy individuals without a history of cancer as controls who came for third molar extraction in same hospital. Both saliva and blood samples were collected from each patient and healthy individual. Patients receiving radio-chemotherapy, history of any other cancer and recurrent cases were excluded from the study. Medical records were retrieved for age, gender, marital status, medical and family history, habits and histopathological grade and written informed consent were obtained from patients and healthy individuals.

Sample collection

A 5 ml of blood and 5 ml of saliva were collected in vacutainer tubes containing ethylene-diamine-tetra-acetic acid (EDTA) (BD Vacutainer/EDTA-Franklin-Lakes-NJUSA) and falcon tubes respectively. The blood and saliva samples were stored at 4ºC and -20ºC respectively until DNA extraction.

DNA extraction

DNA extraction was performed using conventional phenol-chloroform method.10 Briefly, Eppendorf tube (1.5 ml) (Axygen-USA) containing 750-µl of blood (600 µl saliva) and 750 µl of RBCs lysis buffer (in blood samples only) was processed for centrifugation at 13,000 rpm for 1 minute followed by removal of supernatant, resuspension of pellet in 500 µl of RBCs lysis buffer and centrifugation at 13000 rpm for 60 seconds (saliva was centrifuged without adding RBCs lysis buffer). Consecutively, the supernatant was discarded followed by resuspension of pellet in WBCs lysis buffer (500 µl), sodium dodecyl sulfate solution (15 µl) and proteinase-K (10 µl) and incubation at 37 °C overnight (56 °C for 10 hours for saliva). Following incubation, 500 µl solution of freshly prepared phenol/chloroform/isoamyl alcohol in a ratio of 25 µl: 24 µl: 1 µl was added and processed for centrifugation at 13000 rpm for ten minutes. Following centrifugation, top layer was pipetted off into new Eppendorf tube and this step was repeated twice. Subsequently, sodium acetate (55 µl) and
cold iso-propanol (500 µl) were added to the aqueous layer in Eppendorf tube and DNA was precipitated by inverting the tube multiple times (in case of saliva, the tube was then
stored at -40 °C overnight) followed by centrifugation at 13,000 rpm for 10 minutes. The pellet was washed with 70% cold ethanol (200 µl), centrifuged and air-dried at 45 °C for 5 minutes in vacuum (Eppendorf-Hamburg-Germany). Finally, Tris-EDTA-buffer (150 µl) was used to dissolve DNA and incubated at 37°C overnight until further processing.
Quantification of DNA was determined by GenerayUV-photometer (Biometra-Goettingen-Germany) with 260 nanometer (nm) optical-density. The DNA integrity was assessed using 1% agarose-TBE stained with 10 µl ethidiumbromide via electrophoresis. DNA (5 µl) with 5 µl bromophenol blue dye was loaded in gel-wells and electrophoresed at 90 volts for 1.5 hours in 1X-buffer under UV-photometer (Biometra-Goettingen-Germany).

Primers design

Following forward (F) and reverse (R) primers were designed for HPV-16 genes E6 and E7 and human beta globin gene (BG) as internal control using Primer 3, Integrated DNA technologies. Human beta globin is the most commonly used gene to assess quantity of extracted DNA. The sequences of E6, E7 and human beta globin gene (internal control) were retrieved from Ensembl and then hits and alignments were checked with BLASTN and BLAT.

E6: forward 5’GCTGGGTTTCTCTACGTG3’ (62.1°C), reverse 5’AGCGACCCAGAAAGTTAC3’ (62.4 °C) and product-size of 430 base-pairs (bp)
E7: forward 5’GGAGATACACCTACATTGC3’ (60.2°C),reverse 5’TTGTACGCACAACCGAAG3’ (63.3°C) and product-size of 203 bp
BG: forward 5’AGATAGAGCCACTGACCCCA3’ (62.4°C), reverse 5’ACATCCCTCAATCTGCCAGG 3’ (63.3°C) and product-size of 268 bp.

Polymerase chain reaction (PCR) and gel electrophoresis

The 0.2 ml PCR-tube (Axygen-USA) was kept in heating block of the thermal cycler (Biometra-Tpersonal-GottingenGermany). Reaction mixture, with a 25 µl total reaction volume comprised of buffer 2.5µl (100M TrisHcl, 500mM KCL, 8.3 pH), 1.5 of MgCl2 (25mM), 1.5µl dNTPs (10mM, Fermantas-UK), 1µl of forward-reverse primers (0.1M), 0.6 µl of Taq-polymerase (Fermentas-UK), 14.9-15.4 µl of PCR water and 2-2.5 µl of DNA.
Thermocycler conditions for E6, E7 and BG were as follows; initial denaturation (96 °C, 5 minutes) followed by 40 denaturation cycles at 96 °C for 1 minute, annealing for 1 minute (E6 = 57 °C, E7 = 59 °C and BG = 61 °C) and initial and final extension at 72 °C for 1 and 10 minute/s respectively followed by analysis of amplified products on 2 % agarose TBE gel. The TBE gel was stained with 10 µl ethidium bromide followed by electrophoresis at 120-volts for 1.5 hour. Size of amplified product was determined using DNA-gene ladder of 100 base-pairs (MBI-Fermentas-LifeSciences-York-UK). From each PCR-reaction, 3 µl amplifiedsample mixed with 3 µl loading-buffer was loaded in wells. DNA fragments were visualized under UV-photometer (Biometra-Gottingen-Germany) and photographs were captured using digital camera (DC-290-Kodak-USA).

DATA ANALYSIS

The data were entered analyzed using SPSS version 24. The frequency and distribution of clinicopathological variables including gender, age, site, grade, ethnic group and smoking
habits were calculated in percentages. Chi-square test was used to determine the association of HPV-16 and clinicopathological variables. A P-value of less than 0.05 was considered as statistically significant.

RESULTS

The mean age of the HNSCC patients was 57.44 ± 14.98 years with age ranged from 25 to 85 years. Majority of the patients were in fifth and sixth decade. The mean age of controls was 54.92 ± 17.61 years with age ranged from 17 to 82 years. The clinicopathologic parameters and HPV-16 status of the HNSCC and controls are shown in Table 1. Next, the association of HPV-16 positivity in saliva and blood with clinicopathological characteristics was evaluated. No statistically significant association was found between HPV-16 positivity in saliva and blood and clinicopathological characteristics (P > 0.05) as shown in Table 2. A total of 200 extracted DNA (saliva; n = 100, blood; n = 100) were tested in polymerase chain reaction with beta-globin to investigate the presence of DNA prior to HPV-16 E6 and E7. Human beta-globin was successfully detected in all samples (HNSCC and healthy individuals) as shown in Figure 1. Of 100 samples (saliva; n = 50, blood; n = 50) from HNSCC patients, a total of 11 (11%) samples were positive

Table 1: Clinicopathologic parameters and HPV-16 status

Table 2: Association of HPV-16 and head and neck squamous cell carcinoma

Figure 1: Electrophoretogram of 2% agarose gel showing amplified beta globin gene products of 268 bp in normal individuals and HNSCC patients

L1: Lane of 100 bp ladder, Lanes NS1-NS6: Saliva samples Lanes NB1-NB7: Blood samples, Lanes CS1-CS6: Saliva samples Lanes CB1-CB7: Blood samples

Figure 2: Electrophoretogram of 2% agarose gel showing amplified E6 products in HNSCC patients

Lanes CS4, CS8, CS9, CS11, CS13, CS14, CS37 and CS47: Saliva samples, Lanes CB6, B22, B25: Blood samples

Figure 3: Electrophoretogram of 2% agarose gel showing no amplified E7 gene products in HNSCC

Lanes CS1-CS12: Saliva samples, Lanes CB1-CB12: Blood samples

Figure 4: Electrophoretogram of 2% agarose gel showing no amplified E6/E7 gene in normal individuals

Lanes NS1-NS7: Saliva samples, Lanes NB1-NB6: Blood samples

for HPV-16 E6 gene. Of 11 HPV-16 positive samples, 8 (16%) were detected in saliva (n = 50) and 3 (6%) were detected in plasma (n = 50) as shown in Figure 2 and none of the HNSCC samples were positive for HPV-16 E7 gene as shown in Figure 3. Of 100 samples (saliva, n = 50; blood, n = 50) from control group, none of the samples were positive for E6/E7 (Figure 4).

DISCUSSION

In our study, no HPV-16 was observed in both saliva and blood samples in control patients. Our findings are in contrast to Khayani et al. who reported salivary-HPV-16 in 03/35 controls and Gichki et al. who found HPV-16 in 4/200 normal oral tissue scrapings.11,12 The difference in our findings could be due to techniques employed in detecting HPV. We
utilized conventional PCR which is less sensitive in detecting viral-DNA compared to quantitative real-time or nested PCR. However, in accordance with our results, literature also reported negligible or low prevalence of HR-HPV in saliva in healthy individuals indicating the absence of HRHPV-16 in non-HNSCC patients.13,14
Our study showed 11% HPV-16 positivity in HNSCC patients. Furthermore, HPV-16 was detected more in saliva (16%) than blood (6%) particularly in squamous cell carcinomas arising from oropharynx (mandible, tongue, palate, floor of the mouth and pharynx) suggesting that detection of HPV-16 in saliva is site-specific. Our findings are in agreement with previous studies.15,16,17,18 The existence of HPV-16 in saliva is due to the infected cells generating viral particles or the viruses releasing from the dead cells into saliva.15 In contrast, Wang et al. reported 40% (n = 30) and 86% (n = 21) prevalence rates of HPV-16 in saliva and plasma respectively in HNSCC patients. Moreover, they also reported that detection of HPV-16 in plasma was not site-specific and concluded plasma as an optimal biofluid for detecting high-risk HPV-16 in HNSCC.19
In the present study, the smoking rate (46%) in a form of cigarette, bidi and hookah was high compared to chewed tobacco and alcohol in HNSCC patients, however, no significant association was found between overall use of tobacco and HPV-16 which is in agreement with previous study.20 Our data indicate that both tobacco and HPV-16 are independent risk factors for tumorigenesis of HNSCC in Punjab (the largest province of Pakistan). In contrast, previous study reported significant association between HPV-16 and chewed tobacco users.21 The plausible reasons for the difference in findings could be related to sample size (100 oral squamous cell carcinomas compared to 50 HNSCC cases in the current study). Furthermore, we couldn’t find statistically significant association between HPV-16 and age and gender which is in accordance with previous studies, however, others reported significant association of male predominance in HPV-associated HNSCC.20,22,23 Additionally, we couldn’t establish statistically significant association between HPV-16 and ethnicity suggesting that HPV-16 is independent of ethnic diversity in Pakistani population. Microscopically, most of the HNSCC cases present with moderate-poorly differentiated squamous cell carcinoma. The moderately-differentiated are observed with HPVnegative while poorly differentiated are associated with HPV-positive HNSCC, however, no such association was observed in our study.20,24,25 While our findings are consistent with many of the reported studies in literature, it is arduous to compare various
local published studies on HPV-16 mainly due to the wide discrepancy in findings. Plausible reasons of this discrepancy are variations in sample size, type of sample used for instance tissue, saliva, oral scraping or saliva-rinse, techniques employed for HPV-16 detection and studies involving only one subset of HNSCC mainly oral or oropharyngeal squamous-cell-carcinoma.

LIMITATIONS

Detection of HPV-16 in both saliva and plasma (liquid biopsy) with diversified ethnic background and HNSCC subsites was the strength of our study. However, our study had few limitations including small sample size, use of conventional PCR instead of more sensitive techniques due to limited available resources, detection of one HPV-subtype and lack of data on sexual habits due to social and ethical issues.

CONCLUSION

Within the limit of current study, HPV-16 has a low-frequency in the saliva and blood of HNSCC in our population. Moreover, HPV-16 was detected more in saliva than blood particularly in squamous cell carcinomas arising from oropharynx suggesting that detection of HPV-16 in saliva is site-specific. Further studies on HNSCC with large sample including all subsites of squamous cell carcinoma arising in head and neck region, liquid biopsy, other HPV-subtypes, tobacco and non-tobacco users are recommended for future research.

ACKNOWLEDGMENT

The authors are grateful to the staff at Cancer Genetics and Molecular Cancer Therapeutics Lab, Quaid-i-Azam University Islamabad for their help and cooperation and Asif Hanif for statistical analysis.

CONFLICT OF INTEREST

The authors declare no conflict of interest ETHICAL APPROVAL All procedures performed were in accordance with the ethical standards of the institutional research committee and conformed with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards.

REFERENCES

  1. Jou A, Hess J. Epidemiology and molecular biology of head and neck cancer. Oncol Res Treat. 2017;40:328-332. https://doi.org/10.1159/000477127
  2. Perdomo S, Roa GM, Brennan P, Forman D, Sierra MS. Head and neck cancer burden and preventive measures in Central and South America. Cancer Epidemiol. 2016;44:S43-52. https://doi.org/10.1016/j.canep.2016.03.012
  3. Qureshi MA, Mirza T, Khan S, Sikandar B, Zahid M, Aftab M, et al. Cancer patterns in Karachi (all districts), Pakistan: first results (2010-2015) from a pathology-based cancer registry of the largest government-run diagnostic and reference center of Karachi. Cancer Epidemiol. 2016;44:114-122. https://doi.org/10.1016/j.canep.2016.08.011
  4. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68:394-424. https://doi.org/10.3322/caac.21492
  5. Farsi NJ, Rousseau MC, Schlecht N, Castonguay G, Allison P, Nguyen-Tan PF, et al. Aetiological heterogeneity of head and neck squamous cell carcinomas: the role of human papillomavirus infections, smoking and alcohol. Carcinogenesis. 2017;38:1188-1195. https://doi.org/10.1093/carcin/bgx106
  6. Devaraja K, Aggarwal S, Verma SS, Gupta SC. Clinico-pathological peculiarities of human papilloma virus driven head and neck squamous cell carcinoma: A comprehensive update. Life Sci. 2020;245:117383. https://doi.org/10.1016/j.lfs.2020.117383
  7. Gotz C, Bischof C, Wolff KD, Kolk A. Detection of HPV infection in head and neck cancers: Promise and pitfalls in the last ten years: A meta-analysis. Mol Clin Oncol. 2019; 10:17-28. 10.3892/mco.2018.1749
  8. Bukhari N, Joseph JP, Hussain SS, Khan MA, Wakim MJ, Yahya EB, et al. Prevalence of human papilloma virus sub genotypes following head and neck squamous cell carcinomas in asian continent, a systematic review article. Asian Pac J Cancer Prev. 2019;20:3269-3277. https://doi.org/10.31557/APJCP.2019.20.11.3269
  9. Spector ME, Farlow JL, Haring CT, Brenner JC, Birkeland AC. The potential for liquid biopsies in head and neck cancer. Discov Med. 2018;25:251-257.
  10. Sambrook J, Russell DW. Purification of nucleic acids by extraction with phenol:chloroform. CSH Protoc. 2006;2006:pdb.prot4455. https://doi.org/10.1101/pdb.prot4455
  11. Khyani IA, Qureshi MA, Mirza T, Farooq MU. Salivary detection of human Papilloma virus 16 & 18 in pre-malignant and malignant lesions of oral cavity: is it feasible in Pakistani context of socio-cultural taboos? Pak J Med Sci. 2015;31:1104-1109. https://doi.org/10.12669/pjms.315.7093
  12. Gichki AS, Buajeeb W, Doungudomdacha S, Khovidhunkit SO. Detection of human papillomavirus in normal oral cavity in a group of Pakistani subjects using real-time PCR. Asian Pac J Cancer Prev. 2012;13:2299-304. https://doi.org/10.7314/APJCP.2012.13.5.2299
  13. Kreimer AR, Bhatia RK, Messeguer AL, González P, Herrero R, Giuliano AR. Oral human papillomavirus in healthy individuals:  systematic review of the literature. Sex Transm Dis. 2010;37:386-391. https://doi.org/10.1097/OLQ.0b013e3181c94a3b
  14. Gillison ML, Broutian T, Pickard RK, Tong ZY, Xiao W, Kahle L et al. Prevalence of oral HPV infection in the United States, 2009- 2010. JAMA. 2012;307:693-703. https://doi.org/10.1001/jama.2012.101
  15. Wasserman JK, Rourke R, Purgina B, Caulley L, Dimitroulakos J, Corsten M, et al. Correction to: HPV DNA in saliva from patients with SCC of the head and neck is specific for p16-positive oropharyngeal tumours. J Otolaryngol Head Neck Surg. 2018;47:49. https://doi.org/10.1186/s40463-018-0294-7
  16. Fauzi FH, Hamzan NI, Rahman NA, Mohamad I, Suraiya S, Kallarakkal TG, Mohamad S. Detection of human papillomavirus types 16 and 18 in oral squamous cell carcinoma samples in Malaysia. Arch Orofac Sci. 2019;14:21-29.
  17. Parshad S, Nandi S, Marwah N, Mehta P, Tripathi M, Netrapal et al. Human papillomavirus 16 and 18 in squamous cell carcinoma of oral cavity and sexual practices: A pilot study at a Tertiary Care Hospital of North India. Natl J Maxillofac Surg. 2015;6:185-189. https://doi.org/10.4103/0975-5950.183857
  18. Awan MS, Irfan B, Zahid I, Mirza Y, Ali SA. Comparison of polymerase chain reaction and immunohistochemistry assays for analysing human papillomavirus infection in oral squamous cell carcinoma. J Clin Diagn Res. 2017;11:XC10-13. https://doi.org/10.7860/JCDR/2017/24742.10119
  19. Wang Y, Springer S, Mulvey CL, Silliman N, Schaefer J, Sausen M, et al. Detection of somatic mutations and HPV in the saliva and plasma of patients with head and neck squamous cell carcinomas. Sci Transl Med. 2015;7:293ra104.
  20. Khasawneh AI, Himsawi N, Abu-Raideh J, Salameh M, Abdullah N, Khasawneh R. Prevalence of human papillomavirus associated with head and neck squamous cell carcinoma in Jordanian patients. Open Microbiol J [Internet]. 2020 April [cited 2020 May 7];14:57-64. Available from: https://benthamopen.com/FULLTEXT/TOMICROJ14-57. https://doi.org/10.2174/1874285802014010057
  21. Zil-E-Rubab, Baig S, Zaman U, Lucky MH. Human papilloma virus 16/18: Fabricator of trouble in oral squamous cell carcinoma. Int J Infect Dis. 2018;69:115-119. https://doi.org/10.1016/j.ijid.2018.02.003
  22. Adnan Ali SM, Awan MS, Atif S, Ali N, Mirza Y. Correlation of human papillomavirus infection and clinical parameters with five-year survival in oral squamous cell carcinoma. J Laryngol Otol. 2018;132:628-635. https://doi.org/10.1017/S0022215118000361
  23. Fakhry C, Krapcho M, Eisele DW, D’Souza G. Head and neck squamous cell cancers in the United States are rare and the risk now is higher among white individuals compared with black individuals. Cancer. 2018;124:2125-2133. https://doi.org/10.1002/cncr.31322
  24. Hennessey PT, Westra WH, Califano JA. Human papillomavirus and head and neck squamous cell carcinoma: Recent evidence and clinical implications. J Dent Res. 2009; 88:300-306. https://doi.org/10.1177/0022034509333371
  25. Abu Qatouseh L, Sabri I, Alkhatib I, Atwa E, Arafat T. Detection of high-risk human papillomavirus genotypes 16 and 18 in head and neck squamous cell carcinomas in Jordan. Asian Pac J Cancer Prev. 2017; 18:1337-1341.

  1. Postgraduate student, Department of Biochemistry, Quaid-i-Azam University, Islamabad
  2. Associate Professor, Department of Oral Pathology, Dow Dental College, Dow University of Health Sciences, Karachi.
  3. Assistant Professor, Department of Oral Pathology, Rashid Latif Dental College, University of Health Sciences, Lahore.
  4. Department of Orthodontics, De’Montmorency College of Dentistry, University of Health Sciences, Lahore.
  5. Associate Professor, Department of Dental Materials, Dow Dental College, Dow University of Health Sciences, Karachi.
  6. Associate Professor, Department of Biochemistry, Quaid-i-Azam University, Islamabad.
  7. Associate Professor, Department of Biochemistry, Quaid-i-Azam University, Islamabad.
    Corresponding author: “Dr. Sofia Ali Syed” < sofia.ali@duhs.edu.pk >

Frequency of HPV-16 in Saliva and Blood in Head and Neck Squamous Cell Carcinoma in Pakistani Population

Saima Saher                                      M,Phil

Sofia Ali Syed                                   BDS, M.Phil

Asifa Iqbal                                         BDS, M.Phil

Faryal Ali Syed                                 BDS

Faiza Amin                                        BDS, MDS

Aneesa Sultan                                  PhD

Mariam Anees                                  PhD

OBJECTIVE: Pakistan is geographically located in the region where prevalence of head and neck squamous cell carcinoma (HNSCC) is high. Human papilloma virus (HPV) subtype-16 plays significant role in heterogeneity of HNSCC. The objective of this study was to evaluate the frequency of HPV-16 in both blood and saliva in HNSCC in our population and its association with clinicopathological features.
METHODOLOGY:
A total of 200 samples comprising 100 blood and 100 saliva samples were collected. Hundred samples (saliva; n=50, blood; n=50) were collected from histopathologically confirmed head and neck squamous cell carcinoma patients and 100 samples (saliva; n=50 saliva, blood; n=50) were collected from healthy individuals without a history of cancer as controls. HPV-16 was detected using conventional polymerase chain reaction and gel-electrophoresis. The frequency and distribution of clinicopathological variables were calculated in percentages. Chi-square test was used to analyze the association of HPV-16 positivity with clinicopathological variables.
RESULTS:
Of 100 samples from HNSCC patients, 11 (11%) samples were positive for HPV-16. Of 11 HPV-16 positive samples, 8 (16%) were detected in saliva (n=50) and 3 (6%) were detected in plasma (n=50). Of 100 samples from control group, both blood and saliva samples were negative for HPV-16. No statistically significant association was found between HPV-16 in saliva and blood and clinicopathological characteristics (P > 0.05).
CONCLUSION:
Within the limit of current study, HPV-16 has a low-frequency in saliva and blood in HNSCC in our population. Further studies on HNSCC with large sample and HPV-subtypes are suggested.
KEYWORD:
Blood; human papilloma virus; saliva; squamous cell carcinoma.
HOW TO CITE:
Saher S, Syed SA, Iqbal A, Syed FA, Amin F, Sultan A, Anees M. Frequency of HPV-16 in saliva and blood in head and neck squamous cell carcinoma in Pakistani population. J Pak Dent Assoc 2020;29(4):228-234.
DOI:
https://doi.org/10.25301/JPDA.294.228
Received:
07 August 2020, Accepted: 03 September 2020
Download PDF

Determination of Lead, Arsenic and Chromium Contents in Two Types of Mineral Trioxide Aggregate Using Atomic Absorption Spectrometry

Tabinda Nawaz Khan                      BDS, MDS

Farhan Raza Khan                           BDS, MS, MCPS, FCPS

OBJECTIVE: To evaluate the acid-soluble Arsenic, Lead, and Chromium contents in the two varieties of Mineral Trioxide Aggregate (MTA) using Atomic Absorption Spectrophotometry.
METHODOLOGY:
Analysis of Arsenic, Lead, and Chromium in the two products of MTS [MProRoot MTA and MTA Angelus] were done using graphite furnace atomic absorption spectrophotometry employing 2.4 mol/L of hydrochloric acid for digestion of materials. The test materials were subjected to incubate in water and simulated body fluid (SBF) so that the leach out metal ions from the material can also be quantified. Descriptive statistics reported along with ANOVA for comparison of quantitative analysis of Arsenic, Lead, and Chromium in the extracts of the two MTA products. One way ANOVA was applied to compare the leach out of metals over 15 days. Level of significance was kept at 0.05.
RESULTS:
Both varieties of MTA [ProRoot MTA and MTA Angelus] leached out extracts into water and SBF showing lower values of Arsenic and Lead contents in accordance to the limit set by ISO 9917-1 (2007). However, extracts of both the products had comparatively higher amount of Chromium ions.
CONCLUSIONS:
The total amount of Arsenic, Chromium, and Lead released from the two cements were found to be far below than what is considered as clinically harmful.
KEYWORDS:
Chromium; Arsenic; Lead, heavy metals; Mineral trioxide aggregate
HOW TO CITE:
Khan TN, Khan FR. Determination of lead, arsenic and chromium contents in two types of mineral trioxide aggregate using atomic absorption spectrometry. J Pak Dent Assoc 2020;29(4):223-227.
DOI:
https://doi.org/10.25301/JPDA.294.223
Received:
26 August 2020, Accepted: 13 September 2020

Mineral trioxide aggregate (MTA) has been used as the material of choice for root-end filling material, root furcal perforation repair material and pulp-capping material in the clinical practice.1 Despite the favorable characteristics physical properties and biocompatibility of MTA, the cost-effectiveness has been regarded as one of the barriers in its widespread clinical use.2 In terms of chemical composition, MTA appears to be similar to the Portland cement.3 This cement commonly used in manufacturing of concrete for the building and construction industry.3 A number of studies have investigated biocompatibility2, physical properties4 and composition3 of Portland cement to explore if it can be used as a viable substitute of MTA. Both products believed to be comparable to each other.2-4 The similarity of Portland cement to ProRoot MTA has been documented in a number of studies.1-5
One of the very important usages of Portland cement is to employ it as a conditioner for industrial waste so that the disposal of sludge produced in the industrial waste containing
toxic metals becomes safe.5 Portland cement is manufactured in a series of procedures which include mixing of calcareous materials and argillaceous materials and then heating it up in a kiln at 1,450oC thereby producing a clinker, which is then grounded with gypsum-forming cement.5 The resultant cement may comprise of some toxic metal contamination in the range of 5 to 100 parts per million (ppm).6 These toxic metals may include bismuth, Arsenic, Lead, copper, Chromium, iron, zinc, cadmium, nickel, and manganese which are integrated in the cement during its production phases.5 As far the toxicity of the Arsenic content in Portland cement is concerned, some previous studies5,6 inferred that Portland cement has the potential to be used in lieu of MTA, however it was advised that use of Portland cement should be avoided in clinical practice without verifying the amount of Arsenic in it.
Presence of many transition metals such as Chromium, Lead, Bismuth, Arsenic, Or Mercury are known to cause health hazards.7 Therefore, due to toxic nature of such elements, it is necessary to analyze their quantities in every day drinking water, food stuff and medicines.7 In this respect, a limit is set by ISO for all toxic metals to provide secure boundaries. Whether such elements in the dental restorative materials or cements could leach out and cause harm to the adjacent tissues, has been investigated earlier as well.6 To date no standard specifications are documented for Arsenic, Cadmium, Lead, Chromium or other heavy metals are listed in ordinary Portland cements certifications.6 For restorative dental materials, ISO 9917-1 (2007)8 clearly specifies a maximum limit of 2 mg/kg and 100 mg/kg for acid-soluble Arsenic and Lead, respectively. However there is no specification related to even Chromium which is usually present in substantial amount in ordinary Portland cements.5
The objective of the present study is to evaluate the concentration of Arsenic, Lead, and Chromium contents in two products of Mineral Trioxide Aggregate (MTA Pro-Root and MTA Angelus) using Atomic Absorption Spectrometry.

METHODOLOGY

It was a laboratory based investigation employing MTA Pro-Root (Dentsply, Switzerland) and MTA Angelus (Angelus, Brazil) conducted at the Pakistan Council of Scientific and Industrial Research (PCSIR) Karachi, Pakistan. Ethical approval was obtained by IRB (Ref No:-IRB-295/DUHS II). Both MTAs products were mixed according to the manufacturer’s instructions, the liquid provided in the ampoule was mixed with the cement content provided in the product sachet.
The mixture was transferred to acid-washed plastic moulds of 20 mm in diameter and 2-mm deep. The prepared mixtures were then cured at 37oC and 100% humidity for 24 hours. A total of nine discs were made from each product. Six discs were reserved for determining the ion release in solutions while the rest of three discs from each set were selected to determine ion content in the cement materials.

DETERMINATION OF ION CONTENT

The discs were grounded into fine powder by using agate mortar and pestle. Two grams powdered material was mixed with 50 mL of 2.4 mol/L of hydrochloric acid to produce a slurry paste which was mixed well, and then allowed to settle for 16 hours. The mixture was then centrifuged (Microfuge 16, Beckman Coulter Benchtop centrifuge unit) at the fixed speed of 14800 rpm for 10 minutes. A total of 1,000 mg/L of stock standard solutions of Arsenic (As), Chromium (Cr) and Lead (Pb) were prepared from their respected salt (Merck, Darmstadt, Germany), in purified water that worked as reagent.
The Arsenic, Lead, and Chromium contents were analyzed using a graphite furnace atomic absorption spectrophotometer (GFAAS; Hitachi Atomic Absorption Spectrophotometer AA-6800; Tokyo, Japan). Measurements were recorded in triplicate and mean values were determined.

DETERMINATION OF ION RELEASE IN SOLUTION

The rest of reserved set of six cement discs from the two types of MTAs were used to analyze ion released in the simulated body fluid solution (SBF) and water. For that, three discs from each set were placed in water and the other three in the SBF using 25 mL of fluid. SBF was prepared as suggested by Kokubo and Takadama.9
The solutions with discs were incubated at 37oC for 2 weeks. The leachate extracts were eventually made up to a standard volume by reagent and were subjected to the measurements for Arsenic, Lead, and Chromium using graphite furnace atomic absorption spectrophotometry.

DATA ANALYSIS

The data were analyzed using SPSS version 23.0. (IBM, USA) The descriptive statistics were reported as means and SD. Parametric tests were performed as the data were normally distributed. Descriptive statistics computed. ANOVA was applied to compare difference in quantitates of Lead, Chromium, and Arsenic in the extracts. Repeated measure analysis of variance was planned to be applied to compare mean difference over time in leachout of each heavy  metal. Level of significance kept at 0.05.

RESULTS

The concentration of Arsenic (As), Chromium (Cr) and Lead (Pb) found in the specimens are reported in table 2. Chromium (Cr) had the highest 7.04±0.06 and 6.07 ±0.07 in the MTA ProRoot and MTA Angelus, respectively. Lead (Pb) had the lowest quantities detected in the two products.

Table 1: MTA products used in the present study

Repeated measure analysis could not be run due to lack of absorbance values detected in water and SBF at 15 days intervals. The mean absorbance values of Chromium (Cr)

Table 2: Comparison of absorbance values of Arsenic, Lead and Chromium in the leach out extract of two products of MTA

ANOVA was applied at 0.05 level of significance Tukey’s HSD showed that absorbance values of Chromium (Cr) were significantly different in the two products of MTA. NA: test not applied due to lack of data in the cells. SBF is simulated body fluid.

were significantly higher compared to Arsenic (Ar) and Lead (Pb) in the two products of MTA. However, the two products were comparable for the quantities of AR, PB and Cr in their leach out extracts.

DISCUSSION

The present study was aimed to analyze the toxic metals within the MTA material and the quantity that leaches out from material when placed in in water or simulated body fluid.
The detection of metal ions depends on the art of extracting elements from a given solution.10,11,12 In this respect Duarte et al13 has suggested using mild acids to extract Arsenic from MTA and Portland cements whereas Karypidou et al10 employed strong acids for dissolution of cements. Some investigators used mixture of two strong acids (like HCl and HNO3) for the same purpose.10 The mixture of HCl and HNO3 in the ratio of 3:1 (aqua regia or King’s water) for digestion is the standard method recommended in ISO 11466.12,14 Aqua regia method has many benefits including its easier use and being economical.12,14 Undoubtedly, this method has turned out to be effective and now widely used for soil related samples. For dental materials, the specified digestion method is documented as standard ISO 9917; the same has been employed in the present study.8
A number of studies have evaluated presence of toxic elements in the restorative materials, including MTAs.6,10,15 The findings clearly suggest that use of MTA is safe. Arsenic was once considered as the choice of poison for murders.16 But in traces, this element is essential for normal body growth and functions.17 This study and others10,15 demonstrate that
Arsenic is present in the MTAs in very little amount and since its quantity is below the threshold specified by ISO, hence the material [MTA] should be considered safe for clinical application.
Similarly, Lead is known to have adverse effects on the neurological system.18 Therefore, many studies have been conducted to understand Lead content in the items such as food, snacks and paints etc. and their impact on well-being.18,19 In the present study, we infer that quantity of Lead in both MTA Pro-Root and MTA Angelus were far below the toxic threshold and hence safe. This is in agreement with other studies as well.10,15,20 Unfortunately ISO doesn’t put any limitation on the Chromium content. The present investigation shows that among all three metals investigated, Chromium was found in the highest quantities. It is potentially alarming situation. Chromium can cause dermatitis, allergic and eczema, mucosal ulcers, perforation of the nasal septum, allergies, asthma, lung cancer, renal pathologies. Once absorbed, it’s considered to be retained in the human body and not excreted thus causing permanent damage to the kidneys.21,22 To date, the true impact of adverse effect of Chromium on human body is not well understood.
One important aspect of the present study is that it also covered the potential of dissolution and leaching out ArsenicLead, and Chromium into water and SBF. Although, the amount were negligible as detected after fifteen days of incubation. However, in another study6 considerably more contents were detected. This may be observed due to difference of the experimental methodologies in the two studies.
There are number of techniques used for the analytical detection of metals in a product. The list includes Neutron activation analysis Ion chromatography, atomic absorption spectroscopy, inductively coupled plasma spectrometry, graphite atomic absorption furnace, inductively coupled plasma spectrometry, X-ray fluorescence, Laser induced breakdown spectroscopy and UV-VIS spectrometry etc.11 Of all these methods, graphite furnace atomic spectrophotometry is considered as most convenient equipment which can give the most precise results and can detect even the ion content in microns. For the same reason, this instrument was employed in the present study. Other strength of the study is that most investigations have measured the clinical performance and sealing ability23 of the MTA ProRoot and MTA Angelus in root defects, but this is the one of the few studies which has investigated the presence of heavy metals in the two types of MTA. The limitations include in vitro design, lack of thermocycling and not using a Portland cement or any other control.

CONCLUSIONS

MTA ProRoot exhibited higher amounts of Arsenic, Chromium and lead compared to MTA Angelus. However, the total amount of these elements in the two products was found to be far below than what is considered as clinically harmful.

AUTHORS’ CONTRIBUTION

TNK carried out the laboratory work and wrote the manuscript. FRK did statistical analysis and critical review. Both authors have contributed substantially and agreed on
the final version of the manuscript.

CONFLICTS OF INTEREST

There are no conflicts of interest regarding this publication.

REFERENCES

  1. Hosoya N , Takigawa T, Horie T ,Maeda H ,Yamamoto Y , Momoi Y , et al. A review of the literature on the efficacy of mineral trioxide aggregate in conservative dentistry. Dent Mater J. 2019; 38: 693-700. https://doi.org/10.4012/dmj.2018-193
  2. Lenji RK, Nourbakhsh AA, Nourbakhsh N, Nourbakhshc M , Mackenzied K.J.D. .Phase formation, microstructure and setting time of MCM-48 mesoporous silica nanocomposites with hydroxyapatite for dental applications: Effect of the Ca/P ratio. Ceramics Int. 2017;43:12857-62. https://doi.org/10.1016/j.ceramint.2017.06.177
  3. Ledesma AF, Santana FHB, Galindo LB, Alatorre JÁA, Ruvalcaba Sil JL. Elemental chemical composition and phase analysis by means of PIXE, DSC, TGA, and DRX of MTA Angelus® and a white Portland cement. Revista Odontológica Mexicana. 2016;20:e182-6. https://doi.org/10.1016/j.rodmex.2016.08.015
  4. Borges AH, Guedes OA, VolpatoLER, Filho GS , Borba AM, Zina O, et al. Physicochemical Properties of MTA and Portland Cement after Addition of Aloe Vera. Iran Endod J. 2017;12:312-7.
  5. Halim N Ab, Kusin FM, Mohamed KN. Heavy metal exposure from co-processing of hazardous wastes for cement production and associated human risk assessment. Int J Environ Sci Technol. 2018; 15:733-42. https://doi.org/10.1007/s13762-017-1431-y
  6. Schembri M, Peplow G, Camilleri J. Analyses of heavy metals in mineral trioxide aggregate and portland cement. J Endod. 2010; 36: 1210-5. https://doi.org/10.1016/j.joen.2010.02.011
  7. Shah MT , Suleman M, Abdul Baqi S, Samiullah1, Sattar A, Khan. Determination of heavy metals in drinking water and their adverse effects on human health. A review.Pure Appl. Biol.2020;9: 96-104. https://doi.org/10.19045/bspab.2020.90012
  8. British Standard Institution Dentistry-Water-based cements Part 1: Powder/liquid acid-base cements. ISO EN 9917-1;2007.
  9. Myszka B, Schüßler M, Hurle K, Demmert B, Detsch R. Phasespecific bioactivity and altered Ostwald ripening pathways of calcium carbonate polymorphs in simulated body fluid. RSC Adv. 2019; 9:18232-44. https://doi.org/10.1039/C9RA01473J
  10. Karypidou A, Trikas E, Dimosiar G , Koulaouzidou E, Economides N , Beltes P. Cytotoxicity and metal content of tricalcium silicatebased endodontic cements. Int J Dent Oral Health.2018;4:20-6.
  11. Eddaif L, Shaban A, Telegdi J. Sensitive detection of heavy metals ions based on the calixarene derivatives-modified piezoelectric resonators: a review, Int J Envir Anal Chem. 2019; 99:824-53. https://doi.org/10.1080/03067319.2019.1616708
  12. Angelopoulou T, Dimitrakos A, Terzopoulou E. et al. Reflectance Spectroscopy (Vis-NIR) for Assessing Soil Heavy Metals Concentrations Determined by two Different Analytical Protocols, Based on ISO 11466 and ISO 14869-1. Water Air Soil Pollut. 2017. Article Number: 436 https://doi.org/10.1007/s11270-017-3609-9
  13. Duarte MA, De Oliveira AC, Demarchi, Yamashita JC, Kuga MC, De Campos Fraga S. Arsenic release provided by MTA and Portland cement. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2005; 99:648-50 https://doi.org/10.1016/j.tripleo.2004.09.015
  14. Shahbazi K, Beheshti M. Comparison of three methods for measuring heavy metals in calcareous soils of Iran. SN Appl Sci. 2019;1:1541-59. https://doi.org/10.1007/s42452-019-1578-x
  15. Tian J , Zhang Y,Lai Z , Li M , Huang Y, Jiang H et al. Ion Release, Microstructural, and Biological Properties of iRoot BP Plus and ProRoot MTA Exposed to an Acidic Environment. J Endod. 2017;43:163-8. https://doi.org/10.1016/j.joen.2016.10.011
  16. Farrell M. Poisons Used in Serial Poisoning. In: Criminology of Serial Poisoners. , Cham: Palgrave Macmillan, 2018: 45-68. https://doi.org/10.1007/978-3-030-01138-3_3
  17. Shraim AM. Rice is a potential dietary source of not only Arsenic but also other toxic elements like Lead and Chromium. Arab J Chem. 2017;10:S3434-43. https://doi.org/10.1016/j.arabjc.2014.02.004
  18. Shvachiy L, Geraldes V, Amaro-Leal Â, Rocha I. Persistent effects on cardiorespiratory and nervous systems induced by long-term Lead exposure: results from a longitudinal study. Neurotox Res. 2020;37:857-70. https://doi.org/10.1007/s12640-020-00162-8
  19. Juric AK, Bata Ml, David W, Sharp D , Schwartz H, Ing A.Risk assessment of dietary Lead exposure among First Nations people living on-reserve in Ontario, Canada using a total diet study and a probabilistic approach. J Hazard Mater. 2018;344:55-63. https://doi.org/10.1016/j.jhazmat.2017.09.035
  20. Chang SW, Shon WJ, Lee WC, Kum KY. Analysis of heavy metal contents in gray and white MTA and 2 kinds of Portland cement: a preliminary study. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2010;109:642-6. https://doi.org/10.1016/j.tripleo.2009.12.017
  21. Barceloux DG. Chromium. J Toxicol Clin Toxicol. 1999;37: 173-94. https://doi.org/10.1081/CLT-100102418
  22. Baruthio F. Toxic effects of Chromium and its compounds. Biol Trace Elem Res. 1992;32:145-53. https://doi.org/10.1007/BF02784599
  23. Hashem AA, Hassanien EE. ProRoot MTA, MTA-Angelus and IRM used to repair large furcation perforations: sealability study. J Endod. 2008;34:59-61. https://doi.org/10.1016/j.joen.2007.09.007

  1. Assistant Professor, Department of Science of Dental Materials, Dow Dental College, Dow University of Health Sciences.
  2. Associate Professor, Operative Dentistry, Dental Section, Department of Surgery, Aga Khan University, Karachi, Pakistan
    Corresponding author: “Dr. Tabinda Nawaz Khan” <tabinda.nawaz@duhs.edu.pk>

 

Determination of Lead, Arsenic and Chromium Contents in Two Types of Mineral Trioxide Aggregate Using Atomic Absorption Spectrometry

Tabinda Nawaz Khan                      BDS, MDS

Farhan Raza Khan                           BDS, MS, MCPS, FCPS

OBJECTIVE: To evaluate the acid-soluble Arsenic, Lead, and Chromium contents in the two varieties of Mineral Trioxide Aggregate (MTA) using Atomic Absorption Spectrophotometry.
METHODOLOGY:
Analysis of Arsenic, Lead, and Chromium in the two products of MTS [MProRoot MTA and MTA Angelus] were done using graphite furnace atomic absorption spectrophotometry employing 2.4 mol/L of hydrochloric acid for digestion of materials. The test materials were subjected to incubate in water and simulated body fluid (SBF) so that the leach out metal ions from the material can also be quantified. Descriptive statistics reported along with ANOVA for comparison of quantitative analysis of Arsenic, Lead, and Chromium in the extracts of the two MTA products. One way ANOVA was applied to compare the leach out of metals over 15 days. Level of significance was kept at 0.05.
RESULTS:
Both varieties of MTA [ProRoot MTA and MTA Angelus] leached out extracts into water and SBF showing lower values of Arsenic and Lead contents in accordance to the limit set by ISO 9917-1 (2007). However, extracts of both the products had comparatively higher amount of Chromium ions.
CONCLUSIONS:
The total amount of Arsenic, Chromium, and Lead released from the two cements were found to be far below than what is considered as clinically harmful.
KEYWORDS:
Chromium; Arsenic; Lead, heavy metals; Mineral trioxide aggregate
HOW TO CITE:
Khan TN, Khan FR. Determination of lead, arsenic and chromium contents in two types of mineral trioxide aggregate using atomic absorption spectrometry. J Pak Dent Assoc 2020;29(4):223-227.
DOI:
https://doi.org/10.25301/JPDA.294.223
Received:
26 August 2020, Accepted: 13 September 2020
Download PDF